ID: 1121516921

View in Genome Browser
Species Human (GRCh38)
Location 14:94558565-94558587
Sequence GGCCCAGTGGTATTTCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121516911_1121516921 20 Left 1121516911 14:94558522-94558544 CCCTGCCGGGGACATCAGTGGTG No data
Right 1121516921 14:94558565-94558587 GGCCCAGTGGTATTTCCTAGGGG No data
1121516912_1121516921 19 Left 1121516912 14:94558523-94558545 CCTGCCGGGGACATCAGTGGTGT No data
Right 1121516921 14:94558565-94558587 GGCCCAGTGGTATTTCCTAGGGG No data
1121516913_1121516921 15 Left 1121516913 14:94558527-94558549 CCGGGGACATCAGTGGTGTCACA No data
Right 1121516921 14:94558565-94558587 GGCCCAGTGGTATTTCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121516921 Original CRISPR GGCCCAGTGGTATTTCCTAG GGG Intergenic
No off target data available for this crispr