ID: 1121517377

View in Genome Browser
Species Human (GRCh38)
Location 14:94561555-94561577
Sequence ATTATCAGTCTTGGGCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121517377_1121517382 11 Left 1121517377 14:94561555-94561577 CCACTTTGCCCAAGACTGATAAT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1121517382 14:94561589-94561611 ATATTTTCAGTGCTAAAACCAGG 0: 1
1: 1
2: 19
3: 133
4: 471
1121517377_1121517383 22 Left 1121517377 14:94561555-94561577 CCACTTTGCCCAAGACTGATAAT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1121517383 14:94561600-94561622 GCTAAAACCAGGAAAGTCCCAGG 0: 4
1: 32
2: 106
3: 229
4: 433
1121517377_1121517385 30 Left 1121517377 14:94561555-94561577 CCACTTTGCCCAAGACTGATAAT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1121517385 14:94561608-94561630 CAGGAAAGTCCCAGGCAAGCTGG 0: 1
1: 6
2: 28
3: 96
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121517377 Original CRISPR ATTATCAGTCTTGGGCAAAG TGG (reversed) Intronic