ID: 1121517417

View in Genome Browser
Species Human (GRCh38)
Location 14:94561745-94561767
Sequence AGGGACACACAGCTGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 875
Summary {0: 1, 1: 0, 2: 14, 3: 132, 4: 728}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121517402_1121517417 28 Left 1121517402 14:94561694-94561716 CCATGGGCACTGGTGGGTGACTA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG 0: 1
1: 0
2: 14
3: 132
4: 728
1121517404_1121517417 3 Left 1121517404 14:94561719-94561741 CCCGGAGACCCAGAAAAGCCTCC 0: 1
1: 0
2: 2
3: 30
4: 287
Right 1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG 0: 1
1: 0
2: 14
3: 132
4: 728
1121517408_1121517417 -5 Left 1121517408 14:94561727-94561749 CCCAGAAAAGCCTCCCCCAGGGA 0: 1
1: 0
2: 0
3: 23
4: 230
Right 1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG 0: 1
1: 0
2: 14
3: 132
4: 728
1121517409_1121517417 -6 Left 1121517409 14:94561728-94561750 CCAGAAAAGCCTCCCCCAGGGAC 0: 1
1: 0
2: 2
3: 27
4: 275
Right 1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG 0: 1
1: 0
2: 14
3: 132
4: 728
1121517405_1121517417 2 Left 1121517405 14:94561720-94561742 CCGGAGACCCAGAAAAGCCTCCC 0: 1
1: 0
2: 3
3: 21
4: 262
Right 1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG 0: 1
1: 0
2: 14
3: 132
4: 728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121517417 Original CRISPR AGGGACACACAGCTGGTACA GGG Intronic
900523245 1:3116234-3116256 AGGGACACACTGCAGAGACACGG - Intronic
900941671 1:5802449-5802471 AAGGTCACACAGCTGGTAAGTGG - Intergenic
901144531 1:7056133-7056155 AAGGACACAGAGCTGGTCCCCGG + Intronic
901146618 1:7069330-7069352 AGGGTCACACAGCTTGTAAGTGG + Intronic
901750500 1:11404196-11404218 AGGGTCACACAGCTGGGAAGTGG - Intergenic
901760769 1:11469749-11469771 AAGGTCACACAGCTAGTAAATGG - Intergenic
901775457 1:11557460-11557482 AAGGACACACAGCTGGCAGGTGG - Intergenic
901862685 1:12084963-12084985 AGGGTCACACAGTTGGGAAATGG + Intronic
901869038 1:12126718-12126740 AGGGTCACACAGCTTGTAAGTGG - Intronic
901873255 1:12151026-12151048 AGGGTCACACAGCTGCTAAGTGG + Intergenic
902450715 1:16495138-16495160 AGGGTCACACAGCTGGTGAGGGG - Intergenic
902502152 1:16918201-16918223 AGGGTCACACAGCTGGTGAGGGG + Intronic
902570788 1:17345939-17345961 AGGGACACACAGGTGGCTCAGGG - Intronic
902632856 1:17715950-17715972 AGGGGCACACAGATAGTAAATGG + Intergenic
902635576 1:17733064-17733086 AAGGCCACACAGCTAGGACATGG + Intergenic
902664345 1:17927149-17927171 AAGGTCACACAGCTGGTACATGG + Intergenic
902697008 1:18146879-18146901 AAGGTCACACAGCTGGTTAATGG + Intronic
902761625 1:18584598-18584620 AAGGTCACACAGCTGGTAAGTGG + Intergenic
902792902 1:18781207-18781229 AAGATCACACAGCAGGTACAAGG - Intergenic
902798019 1:18811907-18811929 AGGGTAACCCAGCTGGCACATGG - Intergenic
902889995 1:19435994-19436016 AAGGTCACACAGCTGGGACCCGG - Intronic
902925350 1:19692354-19692376 AGGGTCACACCGCTGAAACATGG - Intronic
903180353 1:21602076-21602098 AGGGACGCACAGCTAGGACGTGG + Intronic
903414910 1:23175932-23175954 AAGGTCACACAGCTGGTAAGTGG + Intronic
904091600 1:27948864-27948886 AGGGACCCACAGCAGGAAAATGG + Intronic
904282250 1:29428852-29428874 AAGGTCACACAACTGGTGCATGG - Intergenic
904282994 1:29434353-29434375 AAGGTCACACAGCTGGTCCATGG + Intergenic
904382152 1:30118926-30118948 AAGACCACACAGCTGGTAAATGG - Intergenic
904393376 1:30200123-30200145 AAGGTCACATAGCTGGTAAATGG + Intergenic
904481734 1:30798122-30798144 AGGGTCACACAGCTAATAAATGG - Intergenic
904493600 1:30874789-30874811 AAGGACACACAGCTAGTAAGTGG + Intronic
904494315 1:30878136-30878158 AGGGGCACACAGTTGCTACATGG + Intronic
904590422 1:31611893-31611915 AGGATCACACAGCTGGTAAGTGG + Intergenic
904943054 1:34178043-34178065 AGGGACAGAGAGCTGCTCCATGG - Exonic
905006472 1:34714034-34714056 AGGGAGACACAACTGGTACCAGG + Intronic
905321967 1:37124218-37124240 AAGGACACACAGCTGGTAAGTGG + Intergenic
905350554 1:37343394-37343416 AGGATCACACAGCCGGGACATGG - Intergenic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
905453133 1:38069913-38069935 GAGGTCACACAGCTGGTAAATGG + Intergenic
905494983 1:38377899-38377921 AGAGACAAACAGCTGGGCCATGG - Intergenic
905581231 1:39083831-39083853 AGGGTCACACAGCTAGTAAATGG + Intronic
905632835 1:39528303-39528325 AAGGACACACAGCTGATGAAGGG + Intergenic
905843278 1:41204137-41204159 AAGGTTACACAGTTGGTACATGG + Intronic
905873034 1:41415887-41415909 AAGGTCACACAGCTCGTAAAAGG + Intergenic
906045749 1:42829816-42829838 AGGGACACAGAGCTAGTAATAGG + Intronic
906059236 1:42937578-42937600 AAGGACACACAGCTAGTAAGTGG - Intronic
906286173 1:44589235-44589257 AAGGTCACACAGCTGGGAAATGG - Intronic
906668439 1:47638139-47638161 AAGGACACAGAGCTGGTGGATGG + Intergenic
906689646 1:47784168-47784190 AAGGTCACACACCTGGTAAAAGG + Intronic
906826255 1:48983700-48983722 AGGGACTCACAGCTAGTAAGTGG - Intronic
906901881 1:49844413-49844435 AGGGAAAAACAGTTGGCACAAGG - Intronic
906975788 1:50571375-50571397 ATGGTCACACAGCTGCTAAATGG - Intronic
907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG + Intergenic
907251859 1:53144974-53144996 AAGGTCACACAGCTGGTTGAAGG - Intergenic
907269263 1:53281075-53281097 AAGGGCACACAGCTGGGAAATGG - Intronic
907354796 1:53863314-53863336 AAGGTCCCACAGCTGGTACCCGG - Intronic
907424798 1:54372836-54372858 AGGGCCACACAGCTGGAGAACGG + Intronic
907489186 1:54798178-54798200 AGGGTCACAGAGCTAGTAAATGG - Intronic
907560725 1:55385181-55385203 AAGGTCACACAGCTGGTAAGTGG - Intergenic
907573707 1:55506921-55506943 ATGGACACCCAGCTGGTAGGTGG - Intergenic
907664815 1:56425431-56425453 AAGGTCAAACAGCTGGCACATGG - Intergenic
907738053 1:57135027-57135049 ACTAACACACAGCTAGTACATGG + Intronic
907865972 1:58399531-58399553 AGGTTCACACAGCTGGTAAATGG + Intronic
907873499 1:58464552-58464574 AAGGCCACACAGCTAGTACAAGG - Intronic
908443224 1:64176518-64176540 GGGGTCACACAGCTGGTAAGTGG + Intronic
910113297 1:83704465-83704487 AGAGACAAACAGGTGGCACAAGG - Intergenic
910336380 1:86136612-86136634 AAGGTCACACAGCTGATAAATGG + Intronic
910440068 1:87242646-87242668 AAGGTCACACAGTTGGTAAATGG + Intergenic
910489572 1:87754097-87754119 AAGGACACACATCTGGTAAGTGG + Intergenic
910877192 1:91888146-91888168 AGGCAGAGAGAGCTGGTACACGG - Intronic
912127941 1:106563564-106563586 AGGGACACACTGAAGGTAAAAGG + Intergenic
912386228 1:109272540-109272562 AGGGACCCACAGCAGGAACCAGG + Intronic
912942169 1:114054968-114054990 AAGGTCACACAACTGGTAAATGG + Intergenic
913057580 1:115176459-115176481 AAGGTCACACAGCTAGTAAATGG - Intergenic
913163380 1:116165264-116165286 AGGGTCACACAGCTAGTAAGTGG + Intergenic
914435600 1:147656610-147656632 AGGGACACAAAACTGGTAAATGG - Intronic
915034101 1:152908356-152908378 AGGGACACACAGCTCCTGCCTGG - Intergenic
915160255 1:153914450-153914472 AAGGTCACACAGATGGTAAATGG + Intronic
915165829 1:153947153-153947175 AGGCCCACACGGCTGGTCCAAGG + Intergenic
915276044 1:154788912-154788934 AAGGTCACACAGCTGGTAAGTGG + Intronic
915482550 1:156196973-156196995 AAGGTCACACAGCTGGTCAATGG - Intronic
915499849 1:156308055-156308077 AGGGTCACAAAGCTGGTAAGTGG - Intergenic
915537042 1:156543000-156543022 AGGGCCACACAGCTAGTAAATGG + Intronic
916205137 1:162308935-162308957 ATGGTCACACAGCTGCTGCATGG + Intronic
917121230 1:171646222-171646244 AAAGTCACACAGCTGGGACATGG - Intronic
920037362 1:203075040-203075062 GGGGTCACTCACCTGGTACAGGG + Intronic
920314688 1:205069280-205069302 AGGGAAGCACAGCTAGTAAATGG + Intronic
921714876 1:218407712-218407734 AGGGTCACACAGGTGGGAAATGG + Intronic
922175912 1:223197509-223197531 AGGGTCACACGGCTGGTAAATGG - Intergenic
922316593 1:224447950-224447972 AGGGTCACACAGCTCGTCAAGGG + Intronic
922474615 1:225898655-225898677 AGGGCCACACAGCTGGTGAGTGG + Intronic
922899335 1:229123925-229123947 AAGGACACACAGGTGGACCAAGG + Intergenic
923092361 1:230750230-230750252 AGGGACAGAGGGCTGGTACAGGG - Intronic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
923840267 1:237663464-237663486 AGGGACACACAAGTGGCCCATGG + Intronic
924010421 1:239659304-239659326 AGGGAGACACTGCTGTTACTGGG - Intronic
924534346 1:244921598-244921620 AAGATCACACAGCTGGCACACGG + Intergenic
924543480 1:245003448-245003470 AAGGTCTCACAGCTAGTACATGG + Intronic
924721713 1:246629181-246629203 AGGGCCACACAGCTGGTAAGTGG + Intronic
1062997549 10:1881254-1881276 TGGGATCCACAGCTGGTAAAAGG + Intergenic
1063670759 10:8097865-8097887 AGGCACTCACAGCTCCTACATGG - Intergenic
1064072471 10:12242539-12242561 GGAGACAGTCAGCTGGTACAAGG + Intronic
1064938565 10:20707413-20707435 AAGGACACAGAGCTGGTGCAGGG + Intergenic
1065567583 10:27029903-27029925 AAGGTCACACAGCTGGTAACTGG - Intronic
1065970146 10:30799559-30799581 AGGGGCACACTGCAGGCACAGGG - Intergenic
1067074980 10:43172973-43172995 AGGGGCACATAGCTGGGCCAGGG + Intronic
1067202354 10:44184507-44184529 AGGGAGACACATAAGGTACATGG - Intergenic
1068008373 10:51417436-51417458 AGGGACACACAGCTTGTTGGAGG + Intronic
1068012950 10:51477489-51477511 AGGGACACACAGCTAGTAAATGG - Intronic
1068341751 10:55713262-55713284 AGAAATACACAGCTGTTACAAGG - Intergenic
1069597955 10:69684805-69684827 AGGATCATACAGCTGGAACAGGG + Intergenic
1069698005 10:70401553-70401575 GGGGTCACACAGCTTGTAAACGG + Intergenic
1069885308 10:71619887-71619909 GAGGTCACACAGCTAGTACATGG - Intronic
1069899453 10:71698895-71698917 AAGGTCACACAGCTGGTAAGTGG - Intronic
1069917770 10:71797873-71797895 AGGTACAGACAGCTGCTATAGGG + Intronic
1070165441 10:73894152-73894174 AAGGCCACACAGCTAGTAAATGG + Intergenic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1070636936 10:78136498-78136520 AAGGACACACAGCTAGAAAAGGG - Intergenic
1070651479 10:78240104-78240126 AAGGAAGCACAGCTGGTACCAGG + Intergenic
1070662754 10:78319396-78319418 AAGGTCACACAGCTAGTAAATGG - Intergenic
1070718137 10:78737478-78737500 AGGGCCACACAGCTAGTGAAAGG + Intergenic
1071782485 10:88861793-88861815 AGGGTCACACAGCTAATACATGG + Intergenic
1071810281 10:89172400-89172422 AGGGTCACACATCTTGTACATGG + Intergenic
1072303727 10:94086800-94086822 AGGGCCACACAGCTGGTCAAGGG - Intronic
1072755867 10:98020464-98020486 AAGGTCACACAGCTAGTACCTGG + Intronic
1073419832 10:103415646-103415668 AGAGTCACACAGCTAATACATGG + Intronic
1073447911 10:103592119-103592141 AGGGCCACACAGCTGGTCAGTGG - Exonic
1073481412 10:103788292-103788314 AGGTTCACACAGCTGGTAAAGGG + Intronic
1073490741 10:103851574-103851596 AGGGTCTCGCAGCTGGCACAGGG - Intronic
1073750726 10:106523854-106523876 AGGAACACTAAGTTGGTACATGG + Intergenic
1074189471 10:111123488-111123510 AGGGTCACACAGTTGGTACGTGG + Intergenic
1074191112 10:111138537-111138559 AAGAACACACAGCTGGTAAATGG + Intergenic
1074720434 10:116259789-116259811 AAGGCCACACAGCTGATACCTGG - Intronic
1074840910 10:117350182-117350204 AGGGATACACAGCTAGTAAGTGG + Intronic
1074869295 10:117564538-117564560 AAGGTCACACAGCTGATAAATGG + Intergenic
1074905319 10:117857539-117857561 AGGGGCACACAGCTATTACGTGG - Intergenic
1075030985 10:119024779-119024801 AAGGACACAAAGCTGGCGCAAGG - Intergenic
1075394431 10:122116472-122116494 AAGGTCACACAGCTGGTAAGGGG - Intronic
1076391360 10:130105334-130105356 AAGGATACACAGCTAGTAAATGG - Intergenic
1077323035 11:1950904-1950926 TGGGCCACCCAGCCGGTACAGGG - Exonic
1077469314 11:2749411-2749433 AGGGTCACACAGTTGGCACCAGG - Intronic
1077497490 11:2893189-2893211 AAGGACACACAGCTAGTAAGAGG - Intronic
1077617186 11:3684985-3685007 AAGGTCACACAGCTAGTAAATGG - Intronic
1077634567 11:3833576-3833598 AGGGTCACACAGCTGGTAAGAGG - Intronic
1078529801 11:12128433-12128455 AAGGTCACATAGCTGGTAAATGG + Intronic
1078735937 11:14020803-14020825 GAGGTCACACAGCTGGTAAATGG - Intronic
1078746448 11:14120091-14120113 AGGGCCACCCAGCTAGTATATGG - Intronic
1078904249 11:15669649-15669671 AGGGTCACACAGCTAATAAATGG + Intergenic
1078939215 11:15982236-15982258 AGGGCCACACAGCTAGTAAATGG - Intronic
1079153838 11:17925858-17925880 AAGATCACACAGCTGGTAAATGG - Intronic
1080104120 11:28494034-28494056 AAGGACACACAGCTAGTAAGTGG - Intergenic
1080328183 11:31102920-31102942 AAAGTCACACAGCTGGTACATGG - Intronic
1080443437 11:32315775-32315797 AAGGTCACACAGCTGGTAACTGG - Intergenic
1080555364 11:33411166-33411188 AGGAACACAAAGCTAGTATAGGG + Intergenic
1080610248 11:33897926-33897948 AGGTACGCACACCTGGAACATGG - Intergenic
1081533107 11:43977816-43977838 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1081756851 11:45550928-45550950 AAGGTCACACAGCTGGTGCCTGG + Intergenic
1081913768 11:46718281-46718303 AGGGACAAAGAGCAGGAACACGG - Intergenic
1082815631 11:57506704-57506726 AAGGTCACACAGCTAGTAAAGGG - Intronic
1082821001 11:57544588-57544610 AAGGTCACACAGCTGGTACATGG - Intronic
1083146446 11:60763351-60763373 AAGGACACACAGCTAGTGCAAGG - Intronic
1083146724 11:60765604-60765626 AAGGCCACACAGCTGATAAATGG + Intronic
1083157639 11:60834766-60834788 AGGGACAGGCAGCTGGTAAGTGG - Intergenic
1083226915 11:61291062-61291084 GGGGTCACACAGCTGGTAAATGG - Intronic
1083640095 11:64140775-64140797 AAGGTCACAAAGCTGGTACACGG + Intronic
1083882298 11:65554592-65554614 AGGGTCGCACAGCTGGCACATGG - Intronic
1084028841 11:66468890-66468912 AAGGGCACACAGCTGGTAAGTGG + Exonic
1084447085 11:69209877-69209899 AGGGTCACGCAGCTGGGAAAGGG - Intergenic
1084659245 11:70537435-70537457 GGAGACACACAGCTGGGAGAGGG + Intronic
1084683226 11:70679293-70679315 AAGGTCACACAGCTGGCAAATGG + Intronic
1084850945 11:71939655-71939677 AGGGTCACACAGCTTGTAAGTGG + Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085029765 11:73264009-73264031 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1085228315 11:74942658-74942680 AAGGCCACACAGCTAGTAAATGG - Intronic
1085250551 11:75140791-75140813 AAGGACACACAGGTGGTACGTGG - Intronic
1085534186 11:77208258-77208280 GGGGACACTCAGCAGGCACATGG + Intronic
1085641969 11:78198289-78198311 AGGGTCACACTGCTGGTACCTGG - Intronic
1085651809 11:78274933-78274955 AAGGTCACACAGCTAGAACACGG - Intronic
1085815996 11:79738109-79738131 AAGGCCACACAGCTAGTAAATGG - Intergenic
1086038970 11:82451829-82451851 AAGGTGACACAGCTGGTAAATGG - Intergenic
1086039064 11:82452839-82452861 AAGGTCACACAGCTAGTAGATGG - Intergenic
1086046082 11:82533729-82533751 AGGATCACACAGCTAGTAAAAGG + Intergenic
1086121177 11:83305744-83305766 AAGGTCACATAGCTGGTAGATGG + Intergenic
1086280401 11:85179956-85179978 AAGGACACACAGCTAGTAGGTGG + Intronic
1086397349 11:86430776-86430798 AAGGTCACACAGCTAGTAAATGG - Intergenic
1087157408 11:94918947-94918969 TAGGACACACAGCTGGTATTGGG - Intergenic
1087176773 11:95103681-95103703 AAGGTCACACAGCTGATAAATGG - Intronic
1089103727 11:115985000-115985022 AAGGGCACAAAGCTGGTAAAGGG - Intergenic
1089166579 11:116482161-116482183 AGGGTCTCACAGCTGGTATGTGG + Intergenic
1089695063 11:120211607-120211629 AGGGAGACGCAGCTGGCCCAAGG + Intronic
1089983442 11:122791283-122791305 AAGGCCACACAGCTGGTAAGTGG - Intronic
1090429552 11:126634658-126634680 AGGTGCACACAGCAGGTACAAGG - Intronic
1090529740 11:127578260-127578282 AGGGTCACACAGCAGGTAGAGGG + Intergenic
1091218401 11:133917385-133917407 AGGGACACAGTGCTGGTCCCTGG + Intronic
1202806020 11_KI270721v1_random:6099-6121 TGGGCCACCCAGCCGGTACAGGG - Intergenic
1091390831 12:125313-125335 AGGGTCACACAGCTCGTAAGAGG + Intronic
1091856821 12:3747177-3747199 AGGGTCACACAGCTGATAAGAGG - Intronic
1091857135 12:3749047-3749069 ATGGTCACACAGCCGATACACGG - Intronic
1092937337 12:13376328-13376350 AGGAACACACAGAAGGTAAAAGG + Exonic
1093026674 12:14251860-14251882 AAGGTCACACAGCTAGTAGAAGG - Intergenic
1093506345 12:19871275-19871297 AAGGCCACACAGCTGGTAAATGG - Intergenic
1094440604 12:30471670-30471692 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1095663387 12:44764939-44764961 AGGCAAACACTGCTGGTTCATGG - Intronic
1095765680 12:45892217-45892239 AGGGTCACATTGCTGGTTCATGG - Intronic
1095874587 12:47066884-47066906 AAGATCACACAGCTGGTAAATGG - Intergenic
1095922903 12:47548644-47548666 AGGGAGAAACAGCTGGTTTATGG + Intergenic
1097325481 12:58271678-58271700 AAGGTCACAAAGCTGGTAAATGG - Intergenic
1098084795 12:66830752-66830774 AAGGTCACACAGCTGCTAAATGG + Intergenic
1099006724 12:77242934-77242956 AGGGTCACATAGCTGGTGCATGG - Intergenic
1099591650 12:84599127-84599149 AAGGTCACAGAGATGGTACATGG - Intergenic
1099948646 12:89274813-89274835 AGAGACACACAGCTGGTCAGTGG - Intergenic
1100708054 12:97223092-97223114 AAGGACACACAGCTTGTAAGTGG + Intergenic
1101092888 12:101305703-101305725 AAGGACACACAGCTGGTTGCAGG - Intronic
1101322713 12:103687257-103687279 AAGATCACACAGCTGGTAAATGG + Intronic
1101442228 12:104712477-104712499 AGGAACACACAGCTAGAAGATGG + Intronic
1101563318 12:105881022-105881044 AAGGTCACCCAGCTAGTACAAGG - Intergenic
1101577269 12:106009216-106009238 AAAGTCACACAGCTGATACATGG - Intergenic
1101631184 12:106496484-106496506 AAGGCCACACAGCTGGTAAGAGG - Intronic
1101658823 12:106748156-106748178 AAGGTCACACAGCTGGCACATGG + Intronic
1101807905 12:108080929-108080951 GGGGACACACAGCTAGTAGGTGG - Intergenic
1101840486 12:108324340-108324362 AAGGTCACACAGCTGGTAAGCGG - Intronic
1101886406 12:108666930-108666952 AGGGTCACACAGCTGATAAAAGG - Intronic
1101978359 12:109382724-109382746 AGTGAAACACAGCTGGAATAGGG + Intronic
1102152422 12:110698006-110698028 AAGGCCACACAGCTGGTAAGAGG + Intronic
1102198688 12:111042515-111042537 AAGGTCACACAGCTGGTAAGTGG - Intronic
1102219779 12:111186639-111186661 AAGGTCACACAGCTGGCAGATGG - Intronic
1102678385 12:114673743-114673765 AAGGTCACACAGCGGGTACATGG - Intronic
1103038944 12:117678820-117678842 AAGACCACACAGCTGGTACAAGG - Intronic
1103058283 12:117838526-117838548 AGGGTCACACAGCTAGTACCTGG - Intronic
1103187671 12:118974794-118974816 AGGGACACACAGTTAGTAAAAGG - Intergenic
1103231174 12:119331890-119331912 AAAGTCACACAGCTGGTAAATGG + Intergenic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103763757 12:123268259-123268281 GGGGACAGACAGCTGGTGCCAGG + Intronic
1103806472 12:123577546-123577568 CAGGACAAACAGCTGGCACATGG - Intergenic
1104024787 12:125017899-125017921 AGGGTCCCACAGCTAGGACAGGG - Intronic
1104048964 12:125183925-125183947 AGAGTCACACAGCTGGGGCATGG + Intergenic
1104071807 12:125352465-125352487 AAGGGCACACAGCTGGTATATGG - Intronic
1104437293 12:128766176-128766198 AGGGACATGCAGCTGGTAGCAGG - Intergenic
1104661292 12:130613015-130613037 AGGGAGAAACAGCTGGTGAATGG - Intronic
1104723437 12:131060080-131060102 AGGGACACAGAGCAGGCACTCGG - Intronic
1106241241 13:27915421-27915443 AGGGACACACAGCTTGTGCAGGG + Intergenic
1106635103 13:31520154-31520176 AAAGACACACGGCTGGTAAATGG - Intergenic
1107645890 13:42493946-42493968 AAGGACACACAGCTAGTAAGTGG - Intergenic
1107790733 13:43999626-43999648 AAGGTCACACAGCTGGTAGTAGG + Intergenic
1108162032 13:47650738-47650760 AGGGCCACACAGCTAGTAAGTGG - Intergenic
1109813595 13:67548425-67548447 AGGGTCACTCAGCTGTTAAAAGG + Intergenic
1110289495 13:73787638-73787660 AAGATCACAAAGCTGGTACATGG + Intronic
1110401129 13:75093235-75093257 AACGTCACACAGCTGGTATATGG - Intergenic
1110416257 13:75256391-75256413 AGAGTCACACAGCTAGTAAACGG - Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1111434095 13:88183919-88183941 AGGGGCACGCAGCTGGAAGAGGG + Intergenic
1112568504 13:100571669-100571691 AAGGTCACACAGCTGAAACACGG - Intronic
1112939534 13:104844721-104844743 TGGGACACACAGCATGTTCAGGG + Intergenic
1113230872 13:108214218-108214240 AGGGAAACACAGCTTGTCAAGGG - Intronic
1113381735 13:109811374-109811396 GGGGACACACAGCTGGTGCAAGG - Intergenic
1114330261 14:21629667-21629689 AAGGACACATAGCTGGTTGATGG + Intergenic
1114416393 14:22547527-22547549 AGAGTCTCTCAGCTGGTACACGG - Intergenic
1114775531 14:25476422-25476444 AGGCACATTCAGCTGGAACAGGG + Intergenic
1115495242 14:33997548-33997570 AGGGCCAGACACCTGGTACATGG + Intronic
1116346320 14:43799456-43799478 AGGGTCCCACAGTTGGTAAATGG + Intergenic
1116672098 14:47855971-47855993 TGGGAAAGACAGCTGATACAAGG - Intergenic
1117508373 14:56424695-56424717 AGGGTCACACGTCTGGTAAAAGG + Intergenic
1117746955 14:58879404-58879426 AAGGTCACACTGCTGGTAAATGG - Intergenic
1117831861 14:59759355-59759377 AGGGTCACACAGCTTGTAAATGG - Intronic
1118011765 14:61616998-61617020 AGGGTCACATAGCTGGAAGATGG + Intronic
1118042880 14:61936673-61936695 GGGGACAGACAGGTGGCACAGGG - Intergenic
1118566419 14:67145989-67146011 AGGGAGACACAGCTGGTCACTGG + Intronic
1118732184 14:68676270-68676292 TGGGTCATTCAGCTGGTACATGG + Intronic
1118913435 14:70080941-70080963 AATGTCACACAGCTGGTAAATGG + Intronic
1119167341 14:72505695-72505717 AAGGTCACACAGCTGGTAGGTGG - Intronic
1119760036 14:77143863-77143885 ATGGTCACACAGCTGGTAAATGG - Intronic
1119917885 14:78419153-78419175 AAGGTCACACAGCTAGTTCATGG + Intronic
1120656115 14:87191875-87191897 AAGTGCACACAGCTGGCACATGG + Intergenic
1121088345 14:91163719-91163741 AGGGTCACACAGCTGCTGCACGG - Intronic
1121126977 14:91414338-91414360 AGTGTCACACTGCTGGTAAAAGG + Intronic
1121425446 14:93847427-93847449 AAGGACACACAGCTGCTACGTGG + Intergenic
1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG + Intronic
1122250870 14:100438860-100438882 AGGGTCACACAGCTGGTAAGAGG + Intronic
1122575082 14:102737057-102737079 AGGGTCACTCAGCTCCTACACGG + Intergenic
1122588146 14:102825489-102825511 AGGGCCCCACAGCTGGCCCAGGG - Intronic
1124240441 15:28023812-28023834 AGAGACATACAGCAGGCACAGGG + Intronic
1125100121 15:35902712-35902734 AGGCAAAGACAGCTTGTACAGGG - Intergenic
1125307968 15:38343682-38343704 AGGTAGACACAGATTGTACAAGG + Intronic
1125421057 15:39504475-39504497 ATGGTCACACAGCTAGTTCATGG + Intergenic
1125439314 15:39684917-39684939 AAGGTCACACAGCTAGTCCAGGG + Intronic
1125607142 15:40946308-40946330 AGGGTCACTCAGCTGGTACGTGG + Intergenic
1125729885 15:41887117-41887139 AAGGCCACACAGCTAGTACGTGG + Intronic
1125758070 15:42079124-42079146 AAGGACACACAGCTAGTAAGAGG + Intronic
1126670472 15:51111073-51111095 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1126908475 15:53392973-53392995 AAGGTCACACAGCCAGTACATGG - Intergenic
1126955067 15:53924301-53924323 AAGGTCACACAGCTGGTAAATGG - Intergenic
1127064757 15:55225295-55225317 AGGGTCACACAGCTAGTAAATGG - Intronic
1127622126 15:60744510-60744532 TGGGCCACACAGCTGGTAAGAGG - Intronic
1127634694 15:60858179-60858201 AGGGAAACACAGCTCATACATGG - Intronic
1128308584 15:66616291-66616313 AGGACCACACAGTTGGCACAAGG - Intronic
1128794044 15:70451917-70451939 AGGCACACACAGCTGGTCAGCGG - Intergenic
1128923800 15:71635929-71635951 AAGGTCACCCAGCTGGTAGATGG + Intronic
1129519979 15:76179433-76179455 GGGGGCACACAGCTAGTCCAGGG + Intronic
1129771397 15:78205541-78205563 AGAGTCACACAGCTGGTAAGAGG - Intronic
1129878159 15:78990444-78990466 GGGGCCACACAGCTGCGACAAGG - Intronic
1130038654 15:80384910-80384932 AGGGTCACACAGCTGGTAAAAGG - Intronic
1130225068 15:82050514-82050536 AGGGTCACACAGCTGGTATGTGG + Intergenic
1130518322 15:84643357-84643379 AAGGCCACACAGCTGGTAACAGG + Exonic
1130542830 15:84834218-84834240 AGGGTCACACAGCTGGCAAATGG - Intronic
1130723587 15:86414883-86414905 AAGGTCACACAGCTAGTAAATGG - Intronic
1130885426 15:88088843-88088865 AGGGTCACACAGCTGGAGAACGG - Intronic
1131228683 15:90645456-90645478 CCTGACCCACAGCTGGTACAGGG - Intergenic
1131387494 15:92019237-92019259 AGGGTCACAGAGCTGGTAAGTGG - Intronic
1131395563 15:92082883-92082905 AAGGTCACACAGCTTGTACATGG - Intronic
1131511038 15:93049667-93049689 ATGCACACACAGCTTGCACACGG + Intronic
1132177307 15:99725882-99725904 ACGACCACACAGCTGGTAAATGG - Intronic
1132318401 15:100907504-100907526 AGGGTCACACAGCTAGCAGATGG + Intronic
1133035925 16:3034247-3034269 AGGGTCACACAGCTGGACGAGGG + Intronic
1133242243 16:4421830-4421852 AAGGACACACAGCTGGTAAGTGG + Intronic
1133248851 16:4466820-4466842 GGGGTCACACTGCTCGTACATGG - Intronic
1133428076 16:5710745-5710767 AGGGACACAGAGCCGGTAATAGG - Intergenic
1133478795 16:6149304-6149326 AAGGACACACATCTGGTAAAGGG - Intronic
1133600150 16:7332179-7332201 ATGGTCACATAGCTCGTACAAGG - Intronic
1133818497 16:9215960-9215982 AGGGCCACACAACTGGGAAATGG - Intergenic
1134567994 16:15267522-15267544 AGGGCCACACAGCTAGTCAATGG - Intergenic
1134734442 16:16488833-16488855 AGGGTCACACAGCTAGTCAATGG + Intergenic
1134844748 16:17430432-17430454 AGAGACACTCAGCCTGTACATGG + Intronic
1134933060 16:18223447-18223469 AGGGTCACACAGCTAGTCAATGG - Intergenic
1135109544 16:19680118-19680140 AAGGTCACACAGTTGGTACATGG - Intronic
1135132356 16:19863430-19863452 AAGGTCACACAGCTGGTAAGGGG + Intronic
1135348665 16:21710629-21710651 AGTGTCACACAGCTAGTAAATGG - Intronic
1135392046 16:22102001-22102023 AAGGTCACACAGCTAGTAGATGG + Intronic
1135717748 16:24787042-24787064 ATGGTCACACAGCTAGTAAATGG + Intronic
1135840852 16:25874854-25874876 AAGGCCACACAGCTAGTATATGG - Intronic
1136062267 16:27734866-27734888 AAGGTCACACAGCTGGTATGTGG - Intronic
1136340891 16:29642523-29642545 ACGGTCACACAGCTGGTAAGGGG - Intergenic
1136531240 16:30870880-30870902 AGGGGCACACAGCTAGTGAATGG - Intronic
1137299362 16:47132894-47132916 AAGGCCTCACAGCTGGTAGAAGG - Intronic
1137535713 16:49323303-49323325 AAGGCCACACAGCTAGTAAAAGG - Intergenic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1137696314 16:50464508-50464530 GGACACACACAGCTGGTACATGG + Intergenic
1137939491 16:52669668-52669690 AAAGTCACACAGCTGGTAAATGG + Intergenic
1138128501 16:54457970-54457992 AAGGTCACACAGCTAGCACACGG + Intergenic
1138317707 16:56084461-56084483 AAGGCCACAGGGCTGGTACATGG - Intergenic
1138417745 16:56880808-56880830 AAGGTCACACAGCTGGCACATGG - Intronic
1138445367 16:57059871-57059893 AGGGCCACATAGCTGGTAAGTGG - Intronic
1138481229 16:57304608-57304630 AGAGTCACACAGCTGATAAATGG + Intergenic
1138752595 16:59441922-59441944 AAGGACACACAGCTGGTATGTGG + Intergenic
1139317148 16:66082608-66082630 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1139824355 16:69745388-69745410 AAGGTCACCCAGCTGGTCCATGG + Intronic
1140259893 16:73368902-73368924 AAGGTCACACAGCTGATAAATGG + Intergenic
1140962499 16:79930057-79930079 AAGCTCACACAGCTGGTACAAGG - Intergenic
1141151450 16:81567309-81567331 AGTGAGACACCGCTGCTACAGGG + Intronic
1141690257 16:85592741-85592763 AAGGTCACACAGCTTGTAAAGGG - Intergenic
1141764529 16:86049743-86049765 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1141887588 16:86903222-86903244 AAGGTCACACAGCTAGTAAAAGG - Intergenic
1142586087 17:974625-974647 AAGGACACACAGCTAATAAACGG + Intronic
1142618541 17:1151058-1151080 AAGGTCACACAGCTGGTAAGGGG - Intronic
1143066016 17:4248052-4248074 AAGGTCACACAGCTAGTAAATGG - Intronic
1143684086 17:8499965-8499987 AGGGTCACACAGCTGGTTCGTGG - Intronic
1145270004 17:21399799-21399821 AGGGACACGCAGCCAGTCCATGG - Intronic
1146118672 17:30168180-30168202 AAGGACAAACAGCTGGTGAATGG - Intronic
1146172006 17:30641653-30641675 AAGGTCACACAGCTATTACATGG - Intergenic
1146185414 17:30721092-30721114 AGGGACACCCAACTGGTAAGGGG - Intergenic
1146299453 17:31676830-31676852 AGGCACACACAGCTGGTGAGTGG - Intergenic
1146345464 17:32057689-32057711 AAGGTCACACAGCTATTACATGG - Intergenic
1146482367 17:33214937-33214959 AGAGTCACACAGCTGGCAAAAGG + Intronic
1146633735 17:34488933-34488955 AAGGCCACACAGCTAGTAAAAGG + Intergenic
1147666342 17:42151028-42151050 AGGGTCACACAACTGGTAAGTGG + Intronic
1147674338 17:42194332-42194354 AGGGACAAGGAGCTGGGACAGGG - Intronic
1147700851 17:42393854-42393876 AAGAACATACAGCTGGTAAATGG + Intergenic
1147906729 17:43828090-43828112 AAGGTCACCCAGCTGGTAAAGGG + Intronic
1148062240 17:44844854-44844876 GAGGATACACAGCTAGTACATGG - Intergenic
1148160271 17:45445818-45445840 AGGGTCACCCAGCTTGTAAATGG + Intronic
1148228592 17:45916832-45916854 AGAGTCACACAGCAGGTTCATGG + Intronic
1148358607 17:46993902-46993924 AAGGTCACACAGCTGGTCCATGG + Intronic
1148431735 17:47649148-47649170 AAGGTCACACAGCTGGTTAATGG - Intergenic
1148440741 17:47710538-47710560 AGGGAAACCCAGCTGGCAGAGGG - Exonic
1148675657 17:49443290-49443312 AAGGCCACACAGCTAGTAAATGG + Intronic
1149375120 17:56035988-56036010 AGGAGCACACAGATGGTAGAAGG - Intergenic
1149754015 17:59172818-59172840 AGGGAGACTCAGGTGGTGCAGGG - Intronic
1150352431 17:64456113-64456135 AAGGTCACACAGCTAGTAAATGG - Intronic
1150391562 17:64792697-64792719 AGGGTCACCCAGCTTGTAAATGG + Intergenic
1150410380 17:64936834-64936856 AGGGTCACCCAGCTTGTAAATGG + Intergenic
1150471529 17:65441578-65441600 AAAGACACACAGCTGGTAAGGGG + Intergenic
1150624716 17:66834576-66834598 GAGGACACACAGCTGGAAAATGG - Intergenic
1150770091 17:68033565-68033587 AGGGTCACACAGCCAGTAAATGG - Intergenic
1150771000 17:68040844-68040866 AGGGACAGACAGATAGTACAAGG + Intronic
1150788004 17:68178232-68178254 AAGGTCACACAGCTGGTCCATGG - Intergenic
1150890526 17:69144053-69144075 AAGGTCACACAGCTAGTACATGG - Intergenic
1151345493 17:73498917-73498939 AAGGTCACACAGCCAGTACACGG - Intronic
1151994645 17:77600988-77601010 GAGGCCACACAGCTGGTAAATGG + Intergenic
1152030825 17:77841911-77841933 AAGGTCACATAGCTGGTAAATGG + Intergenic
1152334315 17:79691707-79691729 TGGGACACAGAGCTGGGCCAGGG + Intergenic
1152561687 17:81081865-81081887 AGGGCCACACAGCAGGGACCAGG + Intronic
1153331064 18:3875572-3875594 AAGGACACACAGCTAGTATGTGG - Intronic
1153513948 18:5887562-5887584 AGGGTTACACAGCTGGTAAATGG - Exonic
1153618283 18:6953605-6953627 AAAGTCACACAGCTGGTAAATGG - Intronic
1154259481 18:12817702-12817724 AAGGTCACACAGCTGGAACATGG + Intronic
1154298761 18:13174612-13174634 AGAGACACAGAGCTGGGGCAAGG - Intergenic
1154301918 18:13201659-13201681 CAGGTCACACAGCTGGTAAATGG - Intergenic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1155247740 18:23925955-23925977 AAGGTCACACAGCTGGTAAGTGG - Intronic
1155578381 18:27275081-27275103 AGGAATTCACAGCTGGTAAAGGG + Intergenic
1155671926 18:28381980-28382002 ATGGGAACACAGCTGGTAAAGGG + Intergenic
1156032449 18:32728311-32728333 AAGGTCACACAGATGGTAAATGG - Intronic
1156495585 18:37523417-37523439 AGGGACACATGGCAGGTACCAGG - Intronic
1156571338 18:38256977-38256999 AGGGTCACACAGCAGGTATAAGG - Intergenic
1157323076 18:46648986-46649008 GGGGATCCCCAGCTGGTACACGG + Intronic
1157365673 18:47061981-47062003 AGGGCCACACAGCTAATAAATGG - Intronic
1157623427 18:49029200-49029222 AGGGCCACCCAGCTGGGACTTGG + Intergenic
1157922789 18:51731071-51731093 AGTATCACACAGCTGGTACCTGG - Intergenic
1159981415 18:74785796-74785818 TGGCACACACAGCATGTACATGG + Intronic
1160736537 19:665189-665211 AGGGACACACAGCCAGTTCGTGG - Intergenic
1160745110 19:707813-707835 AGGGTCACACAGCTTGGAGATGG + Intergenic
1161846634 19:6714917-6714939 AGGGTCACACAGCTTGTAAGTGG - Intronic
1162001670 19:7748129-7748151 AAGGTCACACAGCTGGTAGATGG + Intergenic
1162003408 19:7762633-7762655 AAGGTCACACAGCTGGTAAATGG - Intergenic
1162015733 19:7845608-7845630 AAGGTCACACAGCTGGTTGAGGG + Intronic
1162124471 19:8491837-8491859 AAGGTCACCCAGCTGGTAAATGG + Intronic
1162392604 19:10398483-10398505 CGGGATACCCAGCCGGTACATGG - Intronic
1162528270 19:11219907-11219929 AGGGTCACATAGCAGGTAAATGG + Intronic
1162973358 19:14194604-14194626 AGGGACACTCAACTGGTAAGGGG + Intronic
1163304296 19:16468098-16468120 AGGGACCCACGGAAGGTACAAGG + Intronic
1163535016 19:17872089-17872111 AGAGACAGACAGCGGGGACAGGG + Exonic
1164752612 19:30667951-30667973 AAGGTCACACAGCTGGTAATTGG + Intronic
1164837463 19:31366533-31366555 AGGGTCTCACAGCTGTTAGAAGG + Intergenic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1165223669 19:34338707-34338729 AAGGCCTCACAGCTGGGACAAGG + Intronic
1166019023 19:40008140-40008162 AAGGTCACACAGCTGGTAGGTGG + Intronic
1166329846 19:42071438-42071460 TCGAACACACAGCTGGCACATGG + Intronic
1166647201 19:44540981-44541003 AGGGGCCCAGAGCTGGTACCTGG + Intergenic
1166999437 19:46737213-46737235 AGGGTCACACAGCTGGGATGGGG - Intronic
1167516639 19:49927230-49927252 AGGGTCACACAGCTAGTAAGAGG + Intronic
1168348791 19:55663959-55663981 GAGGACACACAGCTTGTACGTGG + Intronic
1168411392 19:56142327-56142349 AAGGACACAGAGCTGGTAGGAGG + Intronic
924995972 2:361367-361389 AGGGACACACAGAAGATAAAGGG + Intergenic
925980768 2:9175364-9175386 AGTGTCACACAGCTGGTAAGTGG - Intergenic
926072338 2:9907832-9907854 AGGGACACTCAGCTGGTAGATGG + Intronic
926299406 2:11591318-11591340 AGGGCCGCACAGCTGGTGCTGGG + Intronic
926423763 2:12723096-12723118 AGTGCCACACAGCTGGTAGGAGG + Intronic
927249426 2:20984330-20984352 AAAGACACACAGCTAGTAAATGG - Intergenic
928032742 2:27795646-27795668 AGAGTCACAGAGCTGGTAAATGG + Intronic
928317267 2:30255905-30255927 AAGGTCACACAGCTTGTTCATGG - Intronic
928912682 2:36438856-36438878 AAGGTCACACAGCTAGTAAATGG - Intronic
929667608 2:43845363-43845385 AAGGTCACACAGCTGGTAAGTGG - Intronic
929771204 2:44893571-44893593 AGTGTCACACAGCTGGTAGGTGG + Intergenic
930736172 2:54781203-54781225 AGGGACACACAGCTAGTGAGTGG + Intronic
931432229 2:62217324-62217346 AATGTCACACAGCTGGTAAATGG - Intronic
931747010 2:65299489-65299511 AGGGGCACATCGCTGGGACAGGG + Intergenic
932012439 2:67992131-67992153 ATGGTCACATAGCTGGTAGATGG - Intergenic
932456314 2:71852135-71852157 AGGGACCCACCGGGGGTACACGG - Intergenic
932741393 2:74293522-74293544 TGGGAGACAGAGCTGGTAAATGG + Intronic
932758194 2:74423122-74423144 AAGGACATACAGCTAGTAAAGGG - Intronic
932859616 2:75276277-75276299 AAGGTCACACAGCTAGTGCATGG + Intergenic
934011714 2:87826190-87826212 AGGAACACACAGCTAGTAAATGG + Intergenic
934477112 2:94601169-94601191 AAGGTCACACAGCCTGTACATGG - Intronic
934573782 2:95388041-95388063 AAGGTCACACAGCTGGTGAATGG - Intergenic
934912902 2:98275513-98275535 AGCGTCACACAGCTGGAAGATGG + Intronic
935375814 2:102396163-102396185 AGAGTCACACAGCTAGTAAATGG - Intronic
935389911 2:102540181-102540203 AAGGACATACAGCTAGTAAATGG + Intergenic
935963346 2:108448817-108448839 CGGGACCCACAGCTGGTTCCGGG - Exonic
936537387 2:113322934-113322956 AGGGTCATCTAGCTGGTACATGG + Intergenic
936582678 2:113717584-113717606 AGGGCCACACAGCTAGTATGTGG + Intronic
937103714 2:119291308-119291330 ATGGATACACAGCTTGTTCAAGG - Intergenic
937357879 2:121209522-121209544 AGGGACACACAGCTAGTCAGGGG - Intergenic
937368300 2:121280949-121280971 GGGGTCACACAGCTGGAAAATGG + Intronic
937699690 2:124850382-124850404 AGGGACACACAGAGGGAAGAGGG + Intronic
938067574 2:128289618-128289640 AGGGCCACACAGCTGCTGGATGG - Intronic
939698123 2:145354269-145354291 AAGGTCACACAGCTAGTAAATGG + Intergenic
940115327 2:150202228-150202250 AGGGTCACACAGCTTGTAAATGG + Intergenic
940517037 2:154696456-154696478 AAGGTCACACAGCTTGTAAATGG + Intergenic
940958180 2:159752877-159752899 AAGGACACACAGCTGGTAAATGG - Intronic
940986861 2:160059525-160059547 AGGGTCACACGGATGGTAAATGG + Intronic
941284518 2:163592917-163592939 AAGGTCACACAGCTTGTCCATGG + Intergenic
942386136 2:175445110-175445132 AAGGTCACACAGCTGGTAAGTGG - Intergenic
942791463 2:179765959-179765981 AGGGAGACACTGCTGGGAAAAGG + Intronic
942990993 2:182202530-182202552 CCAGTCACACAGCTGGTACATGG + Intronic
943749660 2:191497997-191498019 AAGGCCACACAGCTATTACACGG - Intergenic
944823864 2:203460218-203460240 AAGGTCACACAGCTGATATATGG + Intronic
944835011 2:203570578-203570600 AGAGGCACACAGCTGGCAAATGG - Intergenic
945028226 2:205639545-205639567 AGGATCATACAGCTGGCACATGG - Intergenic
945415789 2:209570367-209570389 AGGGGAACACAGCTGGTAAGTGG - Intronic
946634611 2:221710837-221710859 AAGGACACACAGCTTCTGCAAGG + Intergenic
946726785 2:222669646-222669668 AAAGTCACACAGCTGGTAAATGG - Intergenic
947810015 2:232998287-232998309 AGGATCACACAGCTGGTAAGTGG + Intronic
948529290 2:238593804-238593826 AGTGACACACAGCTGGTGAGGGG + Intergenic
948974952 2:241458289-241458311 AGGGAGTCAGTGCTGGTACAGGG + Intronic
1168830001 20:840719-840741 AGGGACACACAGCTAGAAAGTGG + Intronic
1168845672 20:942904-942926 AAGGACAGACAGCTGGAAAATGG - Intergenic
1168961377 20:1872320-1872342 TGGGACACACATCTGGAAAATGG - Intergenic
1168982876 20:2022871-2022893 AAGGTCACACAGCAAGTACATGG - Intergenic
1169120641 20:3093479-3093501 AGGGATAAACAGCTTGTGCAGGG + Intergenic
1169480677 20:5977337-5977359 AGAGCCACACAGCTGGTGCATGG + Intronic
1169958507 20:11132435-11132457 AAAGACACACAGCTGGAAAATGG + Intergenic
1171031916 20:21684371-21684393 TGGGACACACAGCTGGTGAGTGG + Intergenic
1171070189 20:22061144-22061166 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1171991019 20:31696433-31696455 AGGGACACAAAGCTGGAAAAGGG + Intronic
1172037758 20:32021764-32021786 AGGCTCACACAGCAGGTTCATGG - Intronic
1172038045 20:32024090-32024112 AAGGTCACACAGCTGGTAAGTGG + Intronic
1172161535 20:32872233-32872255 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172248451 20:33462281-33462303 AAGGCCACACAGCTGGTAGTTGG - Intergenic
1172310993 20:33918356-33918378 AGCAAGACACAGGTGGTACAGGG + Intergenic
1172441255 20:34968173-34968195 AGGGTCACTCAGCTTGTAAATGG + Intergenic
1172799700 20:37567213-37567235 AAGGTCACACAGCTTGCACATGG + Intergenic
1172828794 20:37814097-37814119 AAGGTCACACAGCTAGTACCTGG + Intronic
1172899418 20:38323585-38323607 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172943242 20:38668916-38668938 GGAGACACACAGCTGATAAAAGG + Intergenic
1172980783 20:38939965-38939987 AGGGTCACACAGCTGGTAGGTGG + Intronic
1173089904 20:39960669-39960691 AGGGTCACACAGCTAGTAAATGG + Intergenic
1173409192 20:42794514-42794536 TGGGACATTCAGCTGGTAGATGG - Intronic
1173446000 20:43118795-43118817 AAGATCACACAGCTAGTACATGG + Intronic
1173532403 20:43780465-43780487 AAGGACACACAGCTGGAAAGTGG + Intergenic
1173755361 20:45511106-45511128 AGGGCCACACAGCTGGAAAGTGG - Intergenic
1174072060 20:47906183-47906205 CTGGACACACAGCAGCTACAGGG + Intergenic
1174121517 20:48269278-48269300 AAGGTCACACAGCTGGCACAGGG - Intergenic
1174147189 20:48460143-48460165 CTGGACACACAGCAGCTACAGGG - Intergenic
1174305821 20:49613640-49613662 AAGGACACACAGCTAGTACAGGG - Intergenic
1174375107 20:50121382-50121404 AAGGTCACACAGCTGGTAGGTGG - Intronic
1174400796 20:50274873-50274895 AGAGTCATGCAGCTGGTACATGG + Intergenic
1174426663 20:50436468-50436490 AAGGCCACACAGCTAGTACTTGG + Intergenic
1174706672 20:52663542-52663564 AGGGTCACAGAGCGGGAACATGG + Intergenic
1174857134 20:54056983-54057005 AAGGTCACACAGCTAGTACGTGG + Intronic
1175052064 20:56165000-56165022 AAAGACACACAGCTGCTACATGG - Intergenic
1175159077 20:56994637-56994659 AAGGTCACACAGCTGGAAAAAGG - Intergenic
1175194350 20:57232151-57232173 AAGGTCACACAGCTGGTAAGTGG - Intronic
1175330839 20:58162701-58162723 AGTGACACGCAGCGGGGACACGG + Intergenic
1175538434 20:59732282-59732304 AAGGTCACACAGCTGGTAAATGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1178358130 21:31925231-31925253 AGGGTCACATAACTGTTACAGGG - Intronic
1178723838 21:35034133-35034155 AAGGTCACACAGCTGGGAAATGG - Intronic
1179039949 21:37793798-37793820 ATGGACACACAGCTTCTGCAAGG + Intronic
1180538717 22:16421256-16421278 AGGGATACATAGGTGGAACACGG + Intergenic
1180620344 22:17157847-17157869 AAGGGCACACAGCTGGTAAGTGG - Intronic
1180627749 22:17205544-17205566 AAGGACACACAGCTGGTAAATGG - Intronic
1181161733 22:20963760-20963782 AGGGCCACACAGCTGCTAAGTGG - Intergenic
1181531397 22:23519449-23519471 GGGGACACACAGCTGGAAGGTGG - Intergenic
1181673851 22:24439362-24439384 AGGGACACTCAGAAGGTGCAAGG - Intronic
1181747017 22:24962509-24962531 AAGGCCACACAGCTGGTAAGCGG - Intronic
1181988687 22:26820349-26820371 AGGGCCACACAGCTGGTAAGAGG + Intergenic
1182118268 22:27770475-27770497 AAAGTCACACAGCTGGGACAAGG - Intronic
1182349821 22:29692948-29692970 AGGGCCACACAGCTGGTCAGTGG + Intronic
1182824689 22:33254594-33254616 AGGGTCACACAGCTTGTAAGTGG - Intronic
1183003709 22:34882768-34882790 AAGGCCACACAGCTGGGAAAGGG + Intergenic
1183061571 22:35339387-35339409 AAGGACACATAGCTGGTAACTGG - Intronic
1183423805 22:37726611-37726633 AAGGTCACACAGCCGGTAAATGG - Intronic
1183468415 22:37992164-37992186 AAGGACACACAGCTAATAAATGG - Intronic
1184449984 22:44577045-44577067 AGGGTCACACGGCTGGTCCATGG - Intergenic
1184458745 22:44625577-44625599 AGGGACACACCGCTGGTGGGTGG + Intergenic
1184477748 22:44730513-44730535 AGGGTCACTCACCTGGTGCATGG + Intronic
1184490052 22:44803251-44803273 TGGGCTCCACAGCTGGTACAGGG + Intronic
1184601812 22:45548416-45548438 AGGGTCACACAGCAAGTTCATGG - Intronic
1184611142 22:45604238-45604260 AAGGACACACAGCTAGTAAGTGG - Intergenic
1185148589 22:49152027-49152049 ACGGGCACACAGCGGGGACACGG + Intergenic
1185351686 22:50342984-50343006 AGAGACACACACCTGGGGCAGGG - Intergenic
949538303 3:5012612-5012634 AGGGTCACACAGCTGGTCTGTGG + Intergenic
949903541 3:8839439-8839461 AAAGTCACACAGCTAGTACAAGG + Intronic
950160602 3:10757922-10757944 AGGGTCACACAGCTGGGTCTGGG + Intergenic
950260309 3:11538430-11538452 AGGGCCACACAGCTAGCAAATGG - Intronic
950295544 3:11826748-11826770 AAGGTCACTCATCTGGTACATGG - Intronic
950469416 3:13175201-13175223 AGAGTCACACAGCTGGTACTCGG - Intergenic
950525521 3:13520685-13520707 AGGGCCACACAGCATGTGCAGGG - Intergenic
950578227 3:13845948-13845970 AGAGACCCACACCTGGTGCAGGG - Intronic
950708935 3:14801678-14801700 AGGGACACCCAGAAGGAACAGGG + Intergenic
950713927 3:14834282-14834304 AAGGACACACAGCTAGTAAGTGG - Intronic
950876985 3:16284774-16284796 AGAGTCACACAGCTGGTAAGCGG + Intronic
951109075 3:18779899-18779921 AAGGTCACACAGCTAGTACTTGG - Intergenic
951233009 3:20201317-20201339 TGGCACACACAGCTGGACCATGG + Intergenic
951608992 3:24470415-24470437 AAGGTCACATAGCTAGTACATGG - Intronic
951645888 3:24890876-24890898 AAGATCACACAGCTGGTAAATGG - Intergenic
952011899 3:28909137-28909159 AGGGACACACAGGTAGTAAGTGG + Intergenic
952946604 3:38482133-38482155 ATACACACACAGCTGGGACATGG - Intronic
953414305 3:42706902-42706924 AAGGCCACACAGCTGGTAAGTGG + Intronic
953432762 3:42853276-42853298 AAGGACACACAGCAAGTATATGG - Intronic
953657430 3:44864769-44864791 AGGTAGACACAGCAGGTACATGG - Intronic
954070635 3:48140386-48140408 AGGGACACACAGCTGTGAACAGG + Intergenic
954463051 3:50638549-50638571 AGGGGCACAGAGCTGCTAGAGGG + Intronic
954844497 3:53543772-53543794 AGGGTCACATGGCTGGTAAATGG + Intronic
955106954 3:55907697-55907719 AAGGTCACACAGCTGGTAAGTGG - Intronic
955468472 3:59261342-59261364 AAAGTCACACAGCTGGTAAATGG + Intergenic
955593228 3:60560265-60560287 TGGGACACACTCCTAGTACAGGG + Intronic
956271195 3:67448736-67448758 AAGGACATATAGCTGGTACTAGG + Intronic
956473671 3:69596136-69596158 AGAGAAACACAGCAGGTAAAAGG - Intergenic
956856129 3:73276573-73276595 AAGGTCACACAGCTGGAAAACGG + Intergenic
957484587 3:80841996-80842018 AGGGACATATAGCTAGTAAATGG - Intergenic
957522141 3:81331320-81331342 AGGTACACACAACTGATATAAGG + Intergenic
957835785 3:85587602-85587624 AGGGACAGTCATTTGGTACATGG - Intronic
959606981 3:108251554-108251576 AAGGTCACACAGCTGGTATGTGG + Intergenic
960142372 3:114163490-114163512 AAGGACACATAGCTTGTAAAAGG + Intronic
960166995 3:114413824-114413846 AAGGTCACACAGCTGGTAAATGG + Intronic
960982915 3:123248871-123248893 AGGGACACCTAGCTGGTACTGGG - Intronic
962267739 3:133955546-133955568 AGGGGCACCCAGCTGGAAAAGGG + Intronic
962424613 3:135258762-135258784 AGGAACACACCCCTGGAACAAGG + Intronic
962967130 3:140365622-140365644 AAGGCCACACAGATGGTAAATGG + Intronic
963254261 3:143129357-143129379 AAGGTCACACAGCTAGTGCATGG + Intergenic
964055999 3:152458485-152458507 AGGGTCACACAGCCAGTAAATGG + Intronic
964159607 3:153630999-153631021 AAGGTCACACAGCTGGTAAGTGG - Intergenic
965573789 3:170197491-170197513 AAGGTCACACAGCTAGTAAATGG + Intergenic
965727988 3:171739779-171739801 AAGGTCACACAGCTGGTAAGTGG + Intronic
965908515 3:173741385-173741407 AGGGACACACTGATGTTCCAGGG + Intronic
966317180 3:178660732-178660754 AGGGTCACAGAGCTGGTAAAGGG + Intronic
966678501 3:182615096-182615118 AGAGACACATAGCTAGTAAATGG - Intergenic
967493885 3:190121700-190121722 AAGGTCACACAGCTGGTAAACGG - Intronic
968083919 3:195865938-195865960 AGGGCCACGCTGCTGGGACAAGG + Intronic
968903162 4:3440548-3440570 TGGTACACACAGCTGGCACTGGG - Intergenic
968972708 4:3804212-3804234 AGGGACACACACCTGGCAGTGGG - Intergenic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
969200814 4:5604012-5604034 AAGGTCACAAAGCTGGTACATGG - Intronic
969201120 4:5606913-5606935 AAGGTCACACAGCTAGAACATGG + Intronic
969341757 4:6546520-6546542 AGGGCCACACAGCTGGTGAGTGG + Intronic
969517218 4:7654479-7654501 AGGGCCACATAGCTGGTTCATGG - Intronic
969583446 4:8078671-8078693 AGGGTCACACAGCTGGGATGTGG - Intronic
970134840 4:12911312-12911334 AAGGATACACAGCTAGTAGATGG + Intergenic
970603406 4:17658146-17658168 AGGGTCACACAGCTAGTAAATGG - Intronic
971760383 4:30757519-30757541 AAAGGCACACAGCTGATACAGGG - Intronic
972631244 4:40843843-40843865 AAGGTCACACAGCTACTACATGG + Intronic
972712976 4:41616841-41616863 AGGGTCACACAGCTAGTAGATGG + Intronic
972886111 4:43490987-43491009 AAGGACACACAGCTGCTAAGTGG - Intergenic
973978444 4:56285867-56285889 AAAGCCACACAGCTGGTAAATGG + Intronic
974400845 4:61403817-61403839 TAGGACACACAGCTGGTACCTGG + Intronic
975588882 4:75980216-75980238 ATTGATACTCAGCTGGTACATGG - Intronic
976195340 4:82526631-82526653 AGGGTCACACAGCTAGTAAGTGG + Intronic
976834429 4:89354802-89354824 AGAGACACACAGCTGATAAATGG - Intergenic
977808559 4:101332799-101332821 ATGGACACACAGTTGGCATATGG + Intronic
978187656 4:105876009-105876031 AAGGTCACACAGCTAGTAAACGG - Intronic
978671946 4:111259534-111259556 AGGGTCACACAGCTAGTAATTGG + Intergenic
978672081 4:111261358-111261380 AGGGTCACACAGCTAGTAACTGG + Intergenic
978838317 4:113180246-113180268 AGGGTCACTCAGCTGGTAAGTGG - Intronic
979654076 4:123171089-123171111 AGGGTCACACAGCTAGCAAAGGG - Intronic
981582733 4:146266799-146266821 AAGGTCACACAGGTGGTAAATGG - Intronic
981634298 4:146858244-146858266 AAGGTCACACAGCTAGTGCATGG + Intronic
982021139 4:151205872-151205894 AAGGACTCATAGCTGGTAAATGG + Intronic
983055907 4:163098674-163098696 AGGGAGAGAGAGGTGGTACATGG + Intergenic
984546767 4:181114035-181114057 AAGGTCACACAGCTAGTAAACGG - Intergenic
984638568 4:182140705-182140727 AGGCACAAACAGCTGCTACCCGG + Intergenic
984844629 4:184099113-184099135 AGAGTCACACAGCTAGTGCAAGG + Intronic
984896629 4:184547317-184547339 AGGTGCACACAGCTGGGACCTGG - Intergenic
984921497 4:184768218-184768240 AGGGTCATACAGATGGCACATGG + Intronic
985961602 5:3306935-3306957 AGGGACACACCACTTGTGCAGGG - Intergenic
986519813 5:8602702-8602724 AGGGACACACAGAATGTGCAAGG + Intergenic
987106782 5:14647465-14647487 AGGGGCCCACAGATGGTCCAAGG + Intergenic
987135522 5:14896371-14896393 AAGGTCACACAGCTGGTAAGAGG - Intergenic
988615201 5:32768570-32768592 AGGGTCACACAGCTGGCACACGG - Intronic
988674607 5:33419060-33419082 AAGGACACATAGCTAGTAAATGG - Intergenic
989108300 5:37883971-37883993 AAGGTCACACAGTTTGTACAGGG - Intergenic
990935879 5:61148654-61148676 AGAGTCACACAGCTGGTAAATGG + Intronic
991617664 5:68513837-68513859 AAGGTCACACAGCTGGTAAGTGG - Intergenic
992175400 5:74144669-74144691 AAGGACACACAGCTGGGAATTGG - Intergenic
993177295 5:84503056-84503078 AGGGACACTCAGCTGCTAAGTGG - Intergenic
993598512 5:89889967-89889989 AGGAACACACAGCTTGTAAGTGG - Intergenic
994957273 5:106548593-106548615 AGGGACACACAGAAGATTCAAGG + Intergenic
994966245 5:106675716-106675738 AAGGTCACACAGGTAGTACATGG + Intergenic
995371481 5:111423990-111424012 AAGATCACACAGCTGGTCCATGG + Intronic
995541304 5:113188782-113188804 AGGGCCACACAGCTGGTCAGTGG + Intronic
995926662 5:117383089-117383111 AGGGACATTCAACTGGTAAAGGG - Intergenic
996366100 5:122703019-122703041 AAGGACACACAGCTGGCAAAGGG - Intergenic
997304334 5:132826816-132826838 AGGGCCACACAGCTGGGACGTGG + Intronic
997424417 5:133793521-133793543 AAGGTCTCACAGCTGGAACATGG + Intergenic
997621945 5:135304890-135304912 AAGGTCACACAGCTTGTAAAAGG + Intronic
997842904 5:137258209-137258231 AGGTACACACAGCTATTAGAGGG + Intronic
997860279 5:137409503-137409525 AGTGACACACAGCTAGCACATGG - Intronic
998271571 5:140711102-140711124 GGGGACACACAGCAGTGACAAGG - Intergenic
998272419 5:140718758-140718780 AGGGACACACAGCAGTGACAAGG - Intergenic
998297483 5:140985606-140985628 AGCAATACACAGCTGGTTCACGG - Intronic
998489597 5:142534780-142534802 AAGGTCACACAGCTCGTAAATGG - Intergenic
998532306 5:142896762-142896784 AAGAACACACAGCTAGTAAATGG - Intronic
998588546 5:143453621-143453643 AAGGACACACTGCTGGTTGATGG + Intergenic
998923587 5:147098218-147098240 AGGACCACACAGCTAGTAAATGG - Intergenic
999198310 5:149798121-149798143 AGGGCCACACAGCTGGTTAAGGG + Intronic
999292616 5:150436507-150436529 AGGGGCACACAGCTGGAAAGGGG - Intergenic
999371179 5:151056345-151056367 AAGGTCACCCAGCTGGTAAATGG - Intronic
1000162855 5:158617154-158617176 AAGGTCACACAGCTGGGAAATGG - Intergenic
1000221659 5:159220209-159220231 AAGGTCACACAGCTGGTAAGAGG - Intergenic
1000537500 5:162497058-162497080 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1001309528 5:170600989-170601011 AAGGTCACACAGCTGGTAAGTGG - Intronic
1001516295 5:172357502-172357524 AGGGTCACACAGCTAGAAGATGG - Intronic
1001542393 5:172548763-172548785 ACGGTCACACAGCTGGTCAATGG - Intergenic
1001685881 5:173594772-173594794 AAGAACACACAGCTGGTAGGGGG + Intergenic
1001759511 5:174195538-174195560 AGGGGCACACAGCATGTGCATGG + Intronic
1001840672 5:174873692-174873714 AAGGCCACATAGCTGGTAAAAGG + Intergenic
1002419963 5:179140280-179140302 GGGGACACAGAGCTGCTAGAAGG - Intronic
1002493691 5:179597792-179597814 AGGGCCACTCAGCTGGTAAAGGG + Intronic
1003728423 6:8792468-8792490 AAGGTCACACAGCTGGTAAACGG + Intergenic
1003978239 6:11364531-11364553 AAGGCCACACAGCAGGTACATGG + Intronic
1004210246 6:13633564-13633586 AAGGTCACACAGCTAGTAAATGG + Intronic
1004273999 6:14219949-14219971 AGGGTCACCCAGCCGGTAAATGG + Intergenic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1004993666 6:21166953-21166975 AAGGTCACCCAGCTGGTATATGG - Intronic
1007323066 6:41041040-41041062 ATGGCCACAGAGCTGGTTCATGG + Intronic
1007700690 6:43764783-43764805 AGGGCCACTCAGCTGGGCCAAGG - Intergenic
1007765552 6:44157735-44157757 AGGGTCACACAGCTGTTAAGCGG - Intergenic
1007933753 6:45715218-45715240 GGAGGCACACAGCTGGTAAAAGG + Intergenic
1008439420 6:51515701-51515723 AGGGGAACACAGCTGGTCAAGGG + Intergenic
1008526721 6:52414453-52414475 AGGGTCACAGAGCTGGTAAGTGG + Intergenic
1009268422 6:61587313-61587335 AGGGACAGTCAGCTGGTGCTAGG + Intergenic
1009475766 6:64090545-64090567 AGGAACTCACAGCTGTCACATGG - Intronic
1009589934 6:65654637-65654659 ATGGACTCTCAGCTGGTATAGGG - Intronic
1011806980 6:91082930-91082952 ATTGTCACACAGCTGGTAAATGG - Intergenic
1012313993 6:97762395-97762417 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1012445879 6:99306737-99306759 AGGGACACCAAGCTTGTAAATGG - Intronic
1013795594 6:113884925-113884947 GGAGACACACAGCTGCTGCATGG + Intergenic
1013864901 6:114684136-114684158 GGGGTCACACAGTTGGTAAATGG + Intergenic
1014619896 6:123654454-123654476 AAGGTCACCCAGCTGGTCCATGG + Intergenic
1015571244 6:134623506-134623528 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1015629848 6:135221037-135221059 AAAGTCACACAGCTGGTAAAGGG - Intergenic
1015904016 6:138097670-138097692 ATAGCCACACAGCTGGTAAATGG + Intronic
1016894577 6:149039604-149039626 AGGGTCTCATAGCTGGTGCAAGG + Intronic
1016897118 6:149064302-149064324 AGGCTCACACAGCTGGTAAGTGG - Intronic
1017790000 6:157789599-157789621 AAGGTCACACAGCTGATAAATGG - Intronic
1018456359 6:163956767-163956789 AAGGACTCAAAGCTGGTTCAAGG - Intergenic
1018804295 6:167246966-167246988 AGGGACCCAGAGCTGGCGCATGG - Intergenic
1019194300 6:170272288-170272310 TGGGCCACACGGCTGGTGCAGGG - Intergenic
1019479951 7:1261719-1261741 CGGGACCCACAGCAGGTCCAAGG - Intergenic
1019884613 7:3893046-3893068 ATGGACCCACACCTGGTAAACGG - Intronic
1022253419 7:28631355-28631377 AAGGCCACACAGCTGGTATTTGG - Intronic
1022257287 7:28671747-28671769 AAGGTCACACAGCTGGCACGTGG - Intronic
1022291703 7:29010933-29010955 AAGGTCATACAGCTGGTACATGG + Intronic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1023835373 7:44064540-44064562 AGGGACACCCAGCTAGGAAACGG - Intronic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1024047694 7:45596391-45596413 AGGGAGACACACCTGGTCCTGGG + Intronic
1024376197 7:48641567-48641589 AGGGTCAAACAACTGGTACGTGG + Intronic
1024517874 7:50275298-50275320 AGGGACACACAGCAAGTAAGAGG + Intergenic
1025235092 7:57228912-57228934 CTGGACACACAGCAGCTACAGGG + Intergenic
1025238074 7:57248244-57248266 AGTAACACACAGTTGGTACGTGG + Intergenic
1026095225 7:67341512-67341534 AGGGTCACACAGCTGGTAAATGG - Intergenic
1026946749 7:74321058-74321080 AGGGTCACACAGCAGGAGCAGGG - Intronic
1028091737 7:86711036-86711058 AAGGCCACACAGCTACTACATGG - Intronic
1028160334 7:87476999-87477021 CTGGCCAGACAGCTGGTACATGG - Intronic
1028265506 7:88719076-88719098 AGGGTCATTCAGCTGGTAAATGG + Intergenic
1028768577 7:94589045-94589067 AGGGCCACATAGCTAGGACATGG + Intronic
1029624263 7:101709959-101709981 AAGGTCTCACAGCTGGTAAATGG - Intergenic
1030523270 7:110624281-110624303 AGGGTTACACAGTTGGTAAATGG + Intergenic
1030525502 7:110648600-110648622 AGGGTCACACAGCTAGTAAGTGG - Intergenic
1030668724 7:112310381-112310403 AGGGAAACACACCAGGTAAAGGG - Intronic
1030765474 7:113404159-113404181 AAGGTCACAGAGCTGGTAAATGG + Intergenic
1031083536 7:117280651-117280673 AAGGCCACACAGTTGATACATGG - Intronic
1031680554 7:124668236-124668258 AAGTTCACACAGCTGGTACATGG - Intergenic
1031883056 7:127218439-127218461 AAGGCCACACAGCTAGTAAATGG - Intronic
1032402038 7:131630262-131630284 AGGGACACAGAGGTCGAACAGGG + Intergenic
1032552226 7:132794864-132794886 AAGGTCACAGAGCTGGTAAAAGG + Intronic
1032660274 7:133975868-133975890 AAGGACACACAGCTATTAAATGG + Intronic
1032753781 7:134868830-134868852 AGGGCCACACAGCTTGCAAATGG - Intronic
1032779463 7:135152192-135152214 AAGGTCACACAGCTGGTGAATGG + Intronic
1033023400 7:137750032-137750054 AGGGACACACAACTGGCATCAGG + Intronic
1034137528 7:148785036-148785058 AAGGTCACATAGTTGGTACATGG - Intronic
1034406224 7:150904242-150904264 ACAGTCACACAGCTAGTACATGG + Intergenic
1034493459 7:151406642-151406664 AGGGTCCCGCAGCTGGTCCATGG - Intronic
1035473328 7:159125461-159125483 AAGGCCACAGAGCTGGTCCAGGG + Intronic
1036631193 8:10516826-10516848 AAGGTCACATAGCAGGTACATGG + Intergenic
1036769737 8:11570837-11570859 AAGGCCACACAGCTGATAAATGG + Intergenic
1037645772 8:20791494-20791516 AAGGTCACACAGCTGGTAGTTGG - Intergenic
1037806403 8:22060017-22060039 AGGGACACACAGCTGGGGGAGGG + Intronic
1037931791 8:22885336-22885358 AGAGTCACACAGATAGTACAGGG + Intronic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038301510 8:26354655-26354677 AGGTACACACAGTGGGCACATGG - Intronic
1038479836 8:27894247-27894269 AGGGTCACACAGCTGCCACATGG + Intronic
1039731570 8:40284726-40284748 AGGGATTCACAGCTGGTAAATGG + Intergenic
1039966481 8:42287741-42287763 AAGGTCACACAGCTAGTAAATGG + Intronic
1040582803 8:48711118-48711140 AAGGATAGACAGCTGGGACATGG - Intronic
1041582301 8:59475544-59475566 AGGGGAACACAACTGGTTCAAGG + Intergenic
1041661314 8:60404258-60404280 AGTGACACTCAGCTGGTGCCTGG + Intergenic
1042163860 8:65926180-65926202 AAGGCCACAGAGCTGGTATATGG + Intergenic
1042474101 8:69225816-69225838 AAGGTCCCACAGCTGGTAAATGG - Intergenic
1042892696 8:73630721-73630743 AGGGTGACACAGCTAGTAAAGGG - Intronic
1044804235 8:95988496-95988518 AAAGACACACAGCTGGTAGGTGG + Intergenic
1044865416 8:96565985-96566007 AAGATCACACAGCTGGTACGTGG - Intronic
1044887958 8:96799795-96799817 AAGGTCACACAGCTAATACATGG + Intronic
1045579698 8:103465323-103465345 AGGGCCACACAGCTAGTAAGTGG + Intergenic
1046029924 8:108771199-108771221 AAGGTCACACAGCTAGTATATGG - Intronic
1046100817 8:109612103-109612125 AAGGTCACACAGCTTGTAAATGG - Intronic
1046610362 8:116416657-116416679 ATTGACACACAACTGGTAAACGG + Intergenic
1047224411 8:122944209-122944231 AAGGTCACACAGCTAGTTCATGG - Intronic
1047347438 8:124041861-124041883 AGAGTCACACAGCTGATAAATGG - Intronic
1047832412 8:128649398-128649420 ATAGTCACACAGCTTGTACAAGG - Intergenic
1048049073 8:130800161-130800183 AGTGTCACACAGCTGGCAGATGG - Intronic
1048172225 8:132118172-132118194 AGGGTCACATAGCTAGTAAATGG - Intergenic
1048340758 8:133536943-133536965 GAGGACACCCAGCTGGTGCATGG - Intronic
1048360817 8:133695739-133695761 AAGGAGACGCAGCTGGTAGATGG + Intergenic
1049388055 8:142354199-142354221 AGGGCCGCGCAGCTGGTGCAGGG - Intronic
1049410020 8:142469026-142469048 AGGGCCACACAGCTTGTAAGTGG + Intronic
1049429223 8:142551419-142551441 AGGGTCACACAGCTGGGGCCTGG + Intergenic
1049540709 8:143207603-143207625 AGGGAGACACAGTTGGTCCTGGG - Intergenic
1049540718 8:143207638-143207660 AGGGAGACACAGTTGGTCCCAGG - Intergenic
1050024909 9:1323489-1323511 TGGGACACACTGCTTGCACATGG - Intergenic
1050261043 9:3841388-3841410 AAAGCCACACAGCTAGTACATGG - Intronic
1050494382 9:6225447-6225469 AAGGTCACACAGCTAGTAAATGG - Intronic
1050663297 9:7907563-7907585 AGGAACACAGAGGTGGGACAGGG - Intergenic
1050707876 9:8424365-8424387 AAGGTCACACAGCTAGTAAATGG - Intronic
1051680781 9:19605871-19605893 AGGGGCACACAGCTAGTAAGAGG + Intronic
1052023870 9:23554154-23554176 AGGGTCACAAAGCTTGTAAATGG - Intergenic
1053135568 9:35648506-35648528 AAGAACACACAGCTGGTAAGTGG + Intergenic
1053680960 9:40484924-40484946 AAGGTCACACAGCCTGTACATGG + Intergenic
1053930949 9:43113238-43113260 AAGGTCACACAGCCTGTACATGG + Intergenic
1054282753 9:63140011-63140033 AAGGTCACACAGCCTGTACATGG - Intergenic
1054294043 9:63320439-63320461 AAGGTCACACAGCCTGTACATGG + Intergenic
1054392067 9:64624928-64624950 AAGGTCACACAGCCTGTACATGG + Intergenic
1054426715 9:65130139-65130161 AAGGTCACACAGCCTGTACATGG + Intergenic
1054503662 9:65891400-65891422 AAGGTCACACAGCCTGTACATGG - Intronic
1054850531 9:69842679-69842701 AAGGCCACACAGCTGGGACCTGG + Intronic
1055041296 9:71876258-71876280 AAGGACATACAGCTGGCAAACGG - Intronic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056193794 9:84209818-84209840 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1056411040 9:86327484-86327506 AAGGACACACAGCTGGGAAGTGG + Intronic
1056770902 9:89477490-89477512 AGGGACACACAGCACACACAAGG + Intronic
1057197243 9:93121893-93121915 AAGGACACACAGCAGGTCCGTGG - Exonic
1057380488 9:94563061-94563083 TGAGACACACAGCTGGTTCATGG + Intronic
1057830629 9:98403473-98403495 AGGGACACACAGCTGGCTAGTGG - Intronic
1058775450 9:108279135-108279157 AGGGTCATACAGCTAGTAAACGG + Intergenic
1058818334 9:108705998-108706020 AGGGTCTCTGAGCTGGTACATGG - Intergenic
1059820424 9:117966605-117966627 AAGGTCACACAACTGGTAAATGG - Intergenic
1059842985 9:118239241-118239263 AGGGTAAAACAGCTTGTACAAGG + Intergenic
1059944557 9:119395755-119395777 AGGGTCACACAGGTAGTAAATGG - Intergenic
1059969334 9:119648872-119648894 AAGGTCACACAGCTGGTTAATGG + Intergenic
1059990007 9:119856005-119856027 AAGGTCACACAGCTGGTAAATGG + Intergenic
1060400330 9:123344858-123344880 AAGGTCACACAGCTGGTAGAAGG - Intergenic
1060443784 9:123668550-123668572 AAGGTCACACAGCTAGTACGTGG + Intronic
1060449261 9:123721703-123721725 AGGTAAAGACAGCTGGTACAGGG - Intronic
1060578176 9:124717775-124717797 AAGGTCACACAGCTGGTAAGTGG - Intronic
1060640954 9:125238473-125238495 AAGGTCACACAGCTAGTAAAGGG - Intronic
1060814816 9:126629477-126629499 AAGGTCACACAGCTAGTAAATGG + Intronic
1061046294 9:128166915-128166937 AGGGACACCTCGCTGGTACAGGG - Intronic
1061183550 9:129038655-129038677 AAAGTCACACAGCTGGTACTTGG - Intronic
1061216139 9:129223056-129223078 GGGGACACACACCTGGGAAACGG - Intergenic
1061218557 9:129235841-129235863 AAGGACACACAGTGGGTGCAGGG + Intergenic
1061325451 9:129861239-129861261 AGGGTCACCCAGCTGGGAGAGGG - Intronic
1061379251 9:130244220-130244242 GGGGTCACACAGCTGATAAATGG + Intergenic
1061415127 9:130443526-130443548 AAGGACACACAACTGCTGCAAGG + Intergenic
1061542366 9:131284394-131284416 CAGGGCCCACAGCTGGTACAAGG - Intergenic
1061621308 9:131812968-131812990 GGGGAAAAGCAGCTGGTACAGGG - Intergenic
1061733227 9:132633146-132633168 GGGGACACACAGCTGGGAAGTGG + Intronic
1061874583 9:133537373-133537395 AGGGACCCCCAGATGGTAGAGGG - Intronic
1062011429 9:134269044-134269066 AGGGTCACACAGCTTGTGAACGG - Intergenic
1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG + Intronic
1186559434 X:10595138-10595160 AGGGCCACACAACTGGCACATGG + Intronic
1187118592 X:16380908-16380930 AGGGGCACACAGCCTGCACAAGG - Intergenic
1187227870 X:17391304-17391326 AAGGTCACACAGCTGGTAAGTGG - Intronic
1187414529 X:19081568-19081590 AGGGTCACACAGCCAGTAAATGG - Intronic
1187506628 X:19883596-19883618 AGGCACCCACAGCTGGGCCAGGG + Intronic
1188021584 X:25164363-25164385 AGAGACAGACTGTTGGTACATGG + Intergenic
1188632817 X:32389057-32389079 AAGGACAAACAGCTGGTGAATGG - Intronic
1189195778 X:39151173-39151195 AAGGTCACACAGCCAGTACATGG - Intergenic
1189521785 X:41776616-41776638 AGGAACACAAAGTTAGTACAAGG + Intronic
1190089348 X:47424142-47424164 AGGGACACATAGCTAAGACAAGG - Intergenic
1190456641 X:50634225-50634247 AGTGTCACACAGCTGTGACAAGG + Exonic
1190480647 X:50873437-50873459 AGGGTCACACAGCTAGTAAGTGG + Intergenic
1190485022 X:50915470-50915492 AAGGACACACAGCTGGTATGTGG - Intronic
1190755731 X:53400206-53400228 AAGGCCACACAGCTAGTAAATGG + Intronic
1190878852 X:54478563-54478585 AGGGCCACACAGCTAGTAAAAGG - Intronic
1191682263 X:63853214-63853236 ATGGTCACACAGCTGGTAAATGG + Intergenic
1192095166 X:68202953-68202975 AGGGTCACATAGCTGGTAAATGG - Intronic
1192309936 X:70002665-70002687 AGGGTCACACAGCTAGTAAGTGG - Intronic
1192372024 X:70522186-70522208 AAGGTAACACAGCTGGTAAATGG - Intergenic
1194164355 X:90496642-90496664 AAAGTCACAAAGCTGGTACAAGG - Intergenic
1194650324 X:96506582-96506604 AGGTTCACACAGCCGGTAAATGG - Intergenic
1194918909 X:99739771-99739793 AGGGTCACACAGCTGGTAAATGG + Intergenic
1195598572 X:106720722-106720744 AAGGTCACACAGCTGGTAGGTGG - Intronic
1195688928 X:107608308-107608330 AAGGTCACACAGCTGGTAAATGG + Intergenic
1195871001 X:109485617-109485639 AAAGTCACACAGCTGATACATGG + Intergenic
1195888396 X:109666599-109666621 AGGCAGACACAGCTGTTACAAGG + Intronic
1196187390 X:112759076-112759098 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1196200149 X:112877490-112877512 ATAGACACACACCTGTTACAGGG + Intergenic
1196414026 X:115451950-115451972 AAGGCCACACAGCCAGTACATGG - Intergenic
1196774697 X:119327621-119327643 AAGGCCACACAGCTGGTAAGTGG - Intergenic
1197652504 X:129081107-129081129 ATGGTCACACAGCTAGTAAATGG + Intergenic
1197805881 X:130398152-130398174 TAGGTCACACAGCTGGTAAATGG - Intergenic
1197829697 X:130628277-130628299 AAGGTCACACAGCTGGTAAGTGG + Intronic
1197865674 X:131014344-131014366 AGAGTCACACAGCTGGTAATTGG - Intergenic
1198017174 X:132623189-132623211 AAGGTCACAGAGCTGGTAAATGG + Intergenic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1198700565 X:139392974-139392996 AGTGTCACACAGCTGATAAATGG - Intergenic
1198720509 X:139613627-139613649 AAGGACACACAGCCAGTACATGG + Intronic
1198732079 X:139742349-139742371 AAGGACACACAGCTAGTAAGTGG + Intronic
1198838324 X:140829071-140829093 AAGAACACACAGCTAGTAAATGG + Intergenic
1199132770 X:144212357-144212379 AGGAACACACAGCTAGTAAATGG - Intergenic
1199657624 X:150012611-150012633 ACGGTCACACAGCTGGTAGATGG + Intergenic
1199903799 X:152204487-152204509 AGGGTCACACAGTTGGTAAGTGG - Intronic
1200297174 X:154932108-154932130 AAAGTCACACAGCTGGTAAATGG - Intronic
1201057638 Y:10011569-10011591 AGGCCCACACTGCTGGTGCATGG - Intergenic
1202102953 Y:21329825-21329847 AGGCCCACACTGCTGGTACATGG + Intergenic