ID: 1121518079

View in Genome Browser
Species Human (GRCh38)
Location 14:94567043-94567065
Sequence CCGGGTGCCCATGATGCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121518075_1121518079 11 Left 1121518075 14:94567009-94567031 CCAAAGACTTCTATGTTGATGAG 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1121518074_1121518079 12 Left 1121518074 14:94567008-94567030 CCCAAAGACTTCTATGTTGATGA 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1121518073_1121518079 17 Left 1121518073 14:94567003-94567025 CCACTCCCAAAGACTTCTATGTT 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1121518072_1121518079 26 Left 1121518072 14:94566994-94567016 CCTCAAGGACCACTCCCAAAGAC 0: 1
1: 0
2: 0
3: 21
4: 172
Right 1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG 0: 1
1: 0
2: 1
3: 29
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121518079 Original CRISPR CCGGGTGCCCATGATGCTGC AGG Exonic
901171806 1:7264246-7264268 CCTGGTGCAGCTGATGCTGCTGG + Intronic
904583132 1:31562716-31562738 CCAGAGGCCCATGGTGCTGCTGG - Intergenic
905106317 1:35565576-35565598 CCGGGAGGCCATGAGGCTGCAGG + Exonic
905452040 1:38063138-38063160 CAGCCTGCCCATGATGCTGAGGG + Intergenic
910713196 1:90203107-90203129 CCTGGTGACGCTGATGCTGCTGG + Intergenic
912511544 1:110193470-110193492 CCTGGTTCCCAAGATGCTGTGGG - Intronic
915168612 1:153962704-153962726 CCAGGGCCCCATGATGCTTCTGG + Exonic
918471871 1:184883666-184883688 CCGAGTGGCACTGATGCTGCTGG - Intronic
919861404 1:201741229-201741251 CCTGGTGCCCATGGTCTTGCAGG - Intronic
920037965 1:203077682-203077704 TTGGGTTCCCATCATGCTGCTGG - Exonic
920662896 1:207933154-207933176 CCAGGTGCTACTGATGCTGCTGG + Intergenic
921127287 1:212189121-212189143 CCAGGTGCTGTTGATGCTGCTGG - Intergenic
921424125 1:214982816-214982838 CCTGGTGACGCTGATGCTGCTGG - Intergenic
922539420 1:226407809-226407831 CCGGATGGCCATCATGGTGCAGG - Exonic
924707011 1:246509888-246509910 GCAGGTGCCCATGCTGCTGTGGG + Intergenic
1064297232 10:14089459-14089481 CCCTGTGCCCAGCATGCTGCGGG - Intronic
1065874409 10:29984317-29984339 CCAGGTGCCATTGATGCTGTTGG + Intergenic
1067187528 10:44043472-44043494 CCGGGTGCCAGTGATGCATCTGG + Intergenic
1069654410 10:70077170-70077192 CCAGGTGATAATGATGCTGCTGG + Intronic
1070269424 10:74938402-74938424 CCTGGTTCACATGATACTGCTGG - Intronic
1073122820 10:101132590-101132612 TCCGGTGCCCGTGGTGCTGCGGG + Intronic
1075812109 10:125231796-125231818 CCGGGCGCTGCTGATGCTGCTGG + Intergenic
1077296866 11:1830451-1830473 CAGGGTCTCCATGAGGCTGCTGG + Intronic
1078067928 11:8090104-8090126 CCAGGAGCCCCTGATGGTGCAGG + Exonic
1078582808 11:12551812-12551834 CTGGGTGCCCATAATGGGGCAGG + Intergenic
1079087026 11:17453835-17453857 CTGGGAGCCCATGAGGCTGGCGG - Intronic
1081667967 11:44927479-44927501 CCAGGTGCCCAGGCTGCTGGAGG - Intronic
1083475107 11:62910290-62910312 CCGGGCCCCCAGGCTGCTGCAGG - Exonic
1083554378 11:63614227-63614249 GCGGGCGCCCAGGAGGCTGCAGG + Exonic
1083631117 11:64095983-64096005 CCAGGGGCCCATGAGCCTGCAGG + Intronic
1083853963 11:65383069-65383091 CAGGCTGCCGCTGATGCTGCTGG - Intronic
1084218428 11:67663981-67664003 CCGGCTCCCCATGATCCTGCAGG - Intronic
1085507721 11:77069656-77069678 CCAGCTGCCCAGGAGGCTGCTGG - Intronic
1086279185 11:85166016-85166038 CTGGGTGGCGCTGATGCTGCTGG - Intronic
1086825942 11:91496714-91496736 CCAGGTGTTCCTGATGCTGCTGG - Intergenic
1088356974 11:108954451-108954473 CCAGGTGACACTGATGCTGCTGG - Intergenic
1089980184 11:122765794-122765816 CCTGGTGCCCAGGCTGCTCCTGG + Intronic
1090423605 11:126592144-126592166 CTGGGTGCCTATGATGCCTCAGG + Intronic
1091728948 12:2865549-2865571 CAGAGTGCCCATAAGGCTGCTGG - Intronic
1100231193 12:92609741-92609763 CCGGGTGATGCTGATGCTGCTGG + Intergenic
1101591305 12:106127867-106127889 CCCCGTGCCCAGGCTGCTGCAGG + Intronic
1101603590 12:106231496-106231518 CATGGTGCTCATGATGCAGCTGG - Intergenic
1103023799 12:117557523-117557545 CCAGGTGATCCTGATGCTGCTGG + Intronic
1103457807 12:121080031-121080053 CCAGGTGGTCATGCTGCTGCAGG - Intergenic
1104897100 12:132169688-132169710 ACGGGGGCCCCTGAGGCTGCTGG + Intergenic
1106060005 13:26281107-26281129 CTGGTTGCCCAGGATGTTGCAGG - Intronic
1107637156 13:42404037-42404059 ACTGATGCCCATGATGGTGCTGG + Intergenic
1108095110 13:46893397-46893419 CCGGGTGATGCTGATGCTGCTGG + Intronic
1108630728 13:52279308-52279330 CCGGGTGCCCACCCTGCTGGTGG - Intergenic
1110461537 13:75750771-75750793 CCAGGTGACCCTGATGCTGATGG + Intronic
1113560143 13:111272329-111272351 CCGGGAGCCCTTGATGGTTCTGG + Intronic
1113946948 13:114049809-114049831 CCTGGAGCCCATGGTCCTGCAGG - Intronic
1117720594 14:58625213-58625235 CTGAGTGCCCATGATATTGCAGG - Intergenic
1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG + Exonic
1122345543 14:101056503-101056525 GGTGGTGCCCATGATGCTTCTGG + Intergenic
1122353599 14:101111177-101111199 CCTGGTGGTCATGAGGCTGCTGG - Intergenic
1122826021 14:104371025-104371047 CCGGGTGCCGCTGCTGATGCTGG + Intergenic
1123020795 14:105397069-105397091 CCCTGTGCCCCTGCTGCTGCTGG + Exonic
1123053387 14:105558693-105558715 CTGGGAGCCCAGGAGGCTGCCGG + Intergenic
1123076436 14:105669609-105669631 CTGGGTGCCCAAGCTGCTGGAGG + Intergenic
1123077964 14:105679107-105679129 CTGGGAGCCCAGGAGGCTGCCGG + Intergenic
1123091138 14:105742835-105742857 CTGGGTGCCCAAGCTGCTGGAGG + Intergenic
1123096909 14:105771170-105771192 CTGGGTGCCCAAGCTGCTGGAGG + Intergenic
1123161930 14:106287057-106287079 CCGGCTGCCCACGGCGCTGCAGG - Intergenic
1123179972 14:106460452-106460474 CCGGCTGCCCACGGCGCTGCAGG - Intergenic
1123448630 15:20346555-20346577 CCAGCTGCCCACGAGGCTGCTGG - Intergenic
1124360701 15:29034842-29034864 CCAGGTGACACTGATGCTGCTGG + Intronic
1126580670 15:50239843-50239865 CCAGGTGCTGCTGATGCTGCTGG - Intergenic
1127936225 15:63641490-63641512 GCGGCTCCCCATGATGCTTCAGG - Exonic
1128338531 15:66803676-66803698 CCAGGTGCTGCTGATGCTGCTGG - Intergenic
1129229569 15:74189259-74189281 CCAGGTGGCCCTGCTGCTGCTGG - Exonic
1131676384 15:94674697-94674719 CCGGGTTGCCATGGTGATGCAGG - Intergenic
1131819274 15:96255737-96255759 CCAGGTGACACTGATGCTGCAGG - Intergenic
1132024442 15:98392863-98392885 CCAGGTCCCCTTGATGCTGCTGG - Intergenic
1132496257 16:264861-264883 CCGGGTGCCTCTGAGTCTGCCGG - Exonic
1132763994 16:1525277-1525299 CGAGGTGCCCAGGATGCTGTCGG - Exonic
1132905006 16:2278020-2278042 CCGGCTGGCCATCATGGTGCAGG - Exonic
1133181302 16:4056707-4056729 CTGAGTGCCCATGATGCAGAGGG - Intronic
1133210661 16:4261784-4261806 CTCGGTGCGCATGATGCTGGAGG - Exonic
1134193963 16:12144093-12144115 CCAGGTGACACTGATGCTGCTGG + Intronic
1134642954 16:15843870-15843892 CCGGGTGATGATGATGATGCTGG + Intronic
1135941098 16:26822559-26822581 CAGGGTGACCCTGAGGCTGCAGG + Intergenic
1138505761 16:57477549-57477571 CCTTCTGCCCCTGATGCTGCGGG - Intronic
1140041826 16:71413238-71413260 CCAGGTGACCTTGATGCTGGTGG - Intergenic
1141256723 16:82409276-82409298 CCAGGTGATCTTGATGCTGCTGG - Intergenic
1142133889 16:88442952-88442974 TGGGGTGCCCTGGATGCTGCCGG - Intergenic
1142668109 17:1473905-1473927 CCCTGTGCACATGTTGCTGCAGG + Intronic
1143028234 17:3953364-3953386 CCTGGTGCGCATCCTGCTGCTGG - Exonic
1143336308 17:6174180-6174202 CGGGTTGTCCAGGATGCTGCTGG + Intergenic
1143659561 17:8316127-8316149 CCGGCTGCGCATGCTGCTGCAGG + Exonic
1145761961 17:27430268-27430290 GCAGGTGCCCATGTTGCAGCGGG - Intergenic
1146238704 17:31193140-31193162 CCAGGTGACGCTGATGCTGCTGG - Intronic
1147210170 17:38868648-38868670 CCAGGTGCCTCTGGTGCTGCTGG - Intergenic
1147879400 17:43644237-43644259 CCTGGTGCTACTGATGCTGCTGG - Intronic
1148490918 17:48023721-48023743 CCCGGTGCCCATTCTGCTGGAGG + Intergenic
1149269997 17:54967665-54967687 CCGGGTGATGCTGATGCTGCCGG + Intronic
1149509947 17:57232172-57232194 TCTGGTGACAATGATGCTGCTGG - Intergenic
1150138558 17:62709842-62709864 CCCGGTGCCGTTGATGCTGCCGG - Intronic
1150151447 17:62812180-62812202 CCAGGTGTCCATGAAGCTGTTGG - Intergenic
1150893177 17:69178401-69178423 CCGGGTGACGTTGATGCTGCTGG - Intronic
1151555299 17:74843442-74843464 CAGCGTGCTCAAGATGCTGCAGG - Exonic
1151599599 17:75098075-75098097 CCGAGTGACCGTGATGCTGGGGG + Exonic
1152400459 17:80063468-80063490 CATGGTGCCCCTGAGGCTGCCGG - Intronic
1152741509 17:82020440-82020462 CCTGGTGCTCATGATCCTGCAGG + Intronic
1152774537 17:82192555-82192577 CCGTGTGGCCATGATGAAGCTGG - Intronic
1153331600 18:3880085-3880107 CCGGGTGTCCATGACCCTGGCGG - Exonic
1153515923 18:5901140-5901162 CCAGGTGGCACTGATGCTGCTGG - Intergenic
1153552287 18:6274182-6274204 CTGGGTGACACTGATGCTGCTGG - Intronic
1156867048 18:41900409-41900431 CTGGGTGCCCATCATGCTCCAGG - Intergenic
1160192236 18:76723743-76723765 CCAGGTGGCGATGATGATGCTGG + Intergenic
1160838723 19:1136899-1136921 CCGGGTCCCCATGGGGCTGCAGG - Intronic
1160933315 19:1580982-1581004 CCGTCTCCCCACGATGCTGCTGG - Intronic
1160995547 19:1880547-1880569 AGGGGAGCCCATGCTGCTGCTGG + Intronic
1161304691 19:3560552-3560574 CCGGCTGCCCACGGTGATGCAGG + Intronic
1161689445 19:5722617-5722639 CCAGGTGATCTTGATGCTGCTGG - Intronic
1161888980 19:7019958-7019980 CCGTGTGACCCTGATGCTGCTGG + Intergenic
1161890386 19:7032058-7032080 CCGTGTGACCCTGATGCTGCTGG - Intronic
1161891062 19:7038675-7038697 CCGTGTGACCCTGATGCTGCTGG + Intronic
1161892474 19:7050791-7050813 CCGTGTGACCCTGATGCTGCTGG - Intronic
1161893147 19:7057136-7057158 CCGTGTGACCCTGATGCTGCTGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162771921 19:12954215-12954237 CTGGGTGCCCCAGAGGCTGCTGG + Exonic
1163565674 19:18049719-18049741 CAGGGTGACCATGATGCCACTGG + Intergenic
1164509916 19:28888746-28888768 CCGCATGCCCCTGAGGCTGCAGG - Intergenic
1164537732 19:29098956-29098978 CCCTGCCCCCATGATGCTGCTGG + Intergenic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1165388754 19:35526720-35526742 CAAGGTGCCCACCATGCTGCTGG - Exonic
1165388897 19:35527314-35527336 CAGGGGGCCCACCATGCTGCGGG - Exonic
1165388915 19:35527368-35527390 CAGGGGGCCCACCATGCTGCGGG - Exonic
1165388960 19:35527530-35527552 CAGGGGGCCCACCATGCTGCGGG - Exonic
1165717339 19:38054919-38054941 CCGGGAGCCCCTGCTGCTGGTGG + Intronic
1165781440 19:38436751-38436773 CAGCGTGCCCATCATGCTTCAGG - Intronic
1166082249 19:40451406-40451428 CCGGATGCACAAGGTGCTGCGGG - Exonic
1166824786 19:45602054-45602076 CCGGCTGCCCGCGATGCTGCGGG - Intronic
1167031751 19:46966855-46966877 CCCAGTGCCCATGAGGCTGCAGG + Intronic
1167751396 19:51382491-51382513 CATGATGCCCATGATGATGCCGG + Exonic
927959776 2:27233879-27233901 CCTGGTGCCTATGATTCTGCTGG - Intronic
927981704 2:27378603-27378625 CAGGTTGCCCAGGCTGCTGCAGG + Exonic
928579552 2:32693328-32693350 CCAGGTGACGCTGATGCTGCTGG - Intronic
932144684 2:69307062-69307084 CCGGGTGCGGAAGAGGCTGCAGG - Intergenic
932363079 2:71126057-71126079 CAGGCTGCCCATGTTGCTCCTGG + Intronic
932596248 2:73095449-73095471 CCAGCTACCCATGCTGCTGCTGG + Intronic
934115179 2:88783067-88783089 TCAGGTGACCCTGATGCTGCTGG + Intergenic
934628274 2:95884010-95884032 TCGGGTGACGCTGATGCTGCTGG - Intronic
934628399 2:95885886-95885908 TCGGGTGACCCTGATGGTGCTGG - Intronic
934631093 2:95923331-95923353 TCGGGTGACGCTGATGCTGCTGG - Intronic
934631469 2:95928908-95928930 TCAGGTGACCCTGATGCTGCTGG - Intronic
934802564 2:97180075-97180097 TCAGGTGACCCTGATGCTGCTGG + Intronic
934832230 2:97539869-97539891 TCGGGTGACGCTGATGCTGCTGG - Intronic
934832356 2:97541749-97541771 TCGGGTGACCCTGATGGTGCTGG - Intronic
937872042 2:126792866-126792888 CTGGGTGCCAAGGATGGTGCAGG + Intergenic
937970850 2:127547684-127547706 CCAGGTGGCCTTGCTGCTGCTGG - Intronic
939011270 2:136848393-136848415 CCAGGTGCTGTTGATGCTGCAGG + Intronic
939560039 2:143721142-143721164 CCAGGTGCCACTGCTGCTGCTGG + Intronic
940168891 2:150805294-150805316 CCAGGTGACAATGAAGCTGCTGG + Intergenic
941812479 2:169768339-169768361 TCTGGCGCCCATGATGCTGCCGG - Intronic
942307235 2:174620757-174620779 CGGGGTGCACATGATGCCGTGGG + Intronic
946865828 2:224039902-224039924 CTGGGTTCCCAGGACGCTGCGGG - Intergenic
947535971 2:230940658-230940680 CTGGGGGCCCATGCTGCTGCTGG + Intronic
1169033110 20:2428496-2428518 CCAGGTGACGCTGATGCTGCTGG + Intronic
1169785818 20:9358221-9358243 CCAGGTGATCCTGATGCTGCTGG + Intronic
1171367240 20:24633628-24633650 CCAGATGACCCTGATGCTGCTGG - Intronic
1171448106 20:25218751-25218773 CTGGGTGCCCAGCATGCAGCGGG - Intronic
1172149314 20:32779448-32779470 CTGTGTGCCCATAATGTTGCAGG + Intronic
1173199123 20:40941213-40941235 CCAGGTGACACTGATGCTGCTGG + Intergenic
1175550503 20:59814258-59814280 CCGCGTCCCCAGGATGGTGCTGG - Intronic
1175844960 20:62053307-62053329 CCAGGAGCCCATGAGGCCGCGGG + Intronic
1175891231 20:62316916-62316938 CAGGCTGCCGAGGATGCTGCTGG - Exonic
1175929302 20:62486071-62486093 CAGGGCGCCCATGGTGCTGGAGG - Intergenic
1178505650 21:33160840-33160862 CAGGGTTCCCATGATGGTGGTGG + Intergenic
1178636734 21:34310046-34310068 CCAGGTGCTGCTGATGCTGCTGG + Intergenic
1179128299 21:38611775-38611797 CTGGGTGCCGAGGATGCAGCGGG - Intronic
1179368992 21:40786435-40786457 CCGTGTGCTGCTGATGCTGCTGG - Intronic
1179828078 21:43979406-43979428 CCAGGTGGGCATGGTGCTGCTGG - Intronic
1180160780 21:45997875-45997897 CCAGGAGCCAGTGATGCTGCGGG - Intronic
1183588114 22:38764733-38764755 CGGGGTGGCCATCCTGCTGCAGG - Intronic
1184654795 22:45935604-45935626 CTGGGTGCCCCTCAGGCTGCAGG + Intronic
1184671050 22:46012521-46012543 CCGGGGGCCCATGTGGCTGCCGG - Intergenic
1184865306 22:47198910-47198932 CCTTGTGCCCATGAGGCTTCAGG + Intergenic
949300735 3:2581064-2581086 CCAGATGACAATGATGCTGCTGG - Intronic
949783364 3:7714489-7714511 CCTGGTGACAATGATGCTGCTGG - Intronic
949790751 3:7789538-7789560 CCCGGTGACCCTGATGCTGTTGG + Intergenic
950276793 3:11668420-11668442 CCAGCTGCCACTGATGCTGCTGG - Intronic
952157165 3:30655909-30655931 CCGGGTGATCCTGCTGCTGCTGG - Intronic
952348302 3:32509464-32509486 CCAGGTGATGATGATGCTGCTGG + Intergenic
952644646 3:35640086-35640108 CCCGCTGCCCCTGCTGCTGCTGG - Intronic
952957224 3:38564863-38564885 CCAACTGCCCAAGATGCTGCAGG + Intronic
954164709 3:48747389-48747411 CTGTGTGCCCAGGGTGCTGCTGG + Exonic
959593824 3:108107295-108107317 CCAGGTGACACTGATGCTGCTGG + Intergenic
959930775 3:111979389-111979411 CGGGGTGCCCAGAATGCCGCAGG - Intronic
960995709 3:123338910-123338932 CTGGGTGTCCAGGGTGCTGCAGG - Intronic
962425027 3:135262130-135262152 CCAGGTGCTGCTGATGCTGCTGG + Intergenic
963081891 3:141402394-141402416 CCGGGGGTCCATGGTGCTTCCGG - Intronic
963318071 3:143782408-143782430 CCTGGTGCCACTGATGCTGTTGG + Intronic
963511156 3:146250967-146250989 CCCGGTGCCCAGCATTCTGCGGG - Exonic
964119030 3:153163014-153163036 GCGCGTGCCCATGATCCTGGTGG + Exonic
968298674 3:197596738-197596760 CTGGGTGCTGGTGATGCTGCTGG + Intergenic
968597089 4:1491220-1491242 CCGGGTGGCCGTGTGGCTGCAGG + Intergenic
969725302 4:8914970-8914992 CCTGCTTCCCATGAAGCTGCAGG - Intergenic
970321333 4:14878484-14878506 CCAGGTGACACTGATGCTGCTGG + Intergenic
971143956 4:23956336-23956358 CCAGGTGACATTGATGCTGCTGG + Intergenic
971257839 4:25030513-25030535 CTGGGTGCCCAGGATCGTGCCGG - Exonic
973804570 4:54513457-54513479 CCTGCTGCCCAAGTTGCTGCTGG - Intergenic
973822602 4:54676187-54676209 CCAGGTGATCCTGATGCTGCTGG - Intronic
974691779 4:65305910-65305932 ACCTGTGCCCATGCTGCTGCTGG + Intergenic
975262739 4:72323025-72323047 CCTGGTGCGCATGATAATGCTGG - Exonic
979544730 4:121926826-121926848 CCAGGTGCTGCTGATGCTGCTGG - Intronic
980027316 4:127782160-127782182 ACGGCTGCCCAAGAAGCTGCGGG - Exonic
980354666 4:131725434-131725456 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980355196 4:131727940-131727962 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980355742 4:131730424-131730446 CAGGCTGCCCCTGAAGCTGCTGG - Intergenic
980356283 4:131732918-131732940 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980356818 4:131735406-131735428 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980357898 4:131740373-131740395 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980358434 4:131742872-131742894 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980358968 4:131745353-131745375 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980359509 4:131747826-131747848 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980360053 4:131750310-131750332 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980360592 4:131752789-131752811 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980361133 4:131755261-131755283 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980361675 4:131757744-131757766 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
980362216 4:131760216-131760238 CAGGCTGCCCCTGAAGCTGCCGG - Intergenic
981467147 4:145086463-145086485 CCAGGTGGTAATGATGCTGCTGG - Intronic
982038984 4:151376159-151376181 CCAGGTGACACTGATGCTGCTGG - Intergenic
982291695 4:153788826-153788848 TCGCGCGCCCACGATGCTGCAGG - Exonic
982326034 4:154128993-154129015 CCAGATGCCACTGATGCTGCTGG + Intergenic
982436203 4:155384875-155384897 GCAGGTGCCCATGTTGCAGCGGG - Intergenic
983275238 4:165608772-165608794 CCAGGTGCCTATCATGATGCTGG + Intergenic
985713056 5:1441262-1441284 CTGGATGCCCATGATGCGGCTGG + Intronic
989704222 5:44308830-44308852 CCAGGTGTTCCTGATGCTGCTGG - Intronic
990947195 5:61261803-61261825 CCAGGAGCCCCTGAGGCTGCAGG + Intergenic
991115454 5:62949488-62949510 CCAGGTGACGCTGATGCTGCTGG - Intergenic
992649439 5:78843260-78843282 CCAGGTGACATTGATGCTGCTGG + Intronic
992666995 5:79020007-79020029 CCAGGTGACAGTGATGCTGCTGG + Intronic
992890040 5:81195643-81195665 CCGGGTGATGCTGATGCTGCTGG - Intronic
997210507 5:132074260-132074282 CTGGGTGCTCAAGAGGCTGCTGG + Intronic
997588554 5:135059090-135059112 CCCACTGCCCAGGATGCTGCTGG + Intronic
998216838 5:140244034-140244056 CCGGGAGCCCATGACCCAGCTGG - Intronic
999758024 5:154679780-154679802 CAGGGCGTCCATGCTGCTGCGGG - Intergenic
1000382093 5:160638432-160638454 CTGTGTCCCCAAGATGCTGCAGG - Intronic
1001199155 5:169700018-169700040 CTGGGTGACCATGAAGATGCTGG + Exonic
1001827577 5:174758184-174758206 CCAGGTGACACTGATGCTGCTGG + Intergenic
1003035816 6:2639401-2639423 CAGGCTGCCCCTGAGGCTGCGGG - Intergenic
1003858944 6:10304301-10304323 CCGAGTTCTCATGGTGCTGCTGG - Intergenic
1004879336 6:19991396-19991418 CTGGGTGACACTGATGCTGCTGG + Intergenic
1005184735 6:23152841-23152863 CCAGGTGATCCTGATGCTGCTGG + Intergenic
1006117474 6:31782754-31782776 CCGGGAGTCCATGATGCTGATGG + Exonic
1006517951 6:34555148-34555170 CTGGGTGCCCCTGAGGCTGGTGG - Intronic
1007040305 6:38715459-38715481 CCGGGAGGCCCTGATGCAGCCGG + Intronic
1007167382 6:39838378-39838400 CCGGGTGATGCTGATGCTGCTGG + Intronic
1007400310 6:41599270-41599292 GCGGGTCTCCATGATGCTGAGGG - Exonic
1011746102 6:90409294-90409316 CCCGGTGCCCATTATACAGCAGG + Intergenic
1013185121 6:107750819-107750841 CCAGGTACCACTGATGCTGCTGG + Intronic
1013349138 6:109290347-109290369 GCTGGCGCCCATGATGCTGACGG - Intergenic
1013448701 6:110257651-110257673 CCAGCTGCCGATGATGCTGCTGG + Intronic
1013768136 6:113597010-113597032 AAGTGTCCCCATGATGCTGCTGG + Intergenic
1015094559 6:129399422-129399444 CCAGGTGACGCTGATGCTGCTGG + Intronic
1019323063 7:424409-424431 CCGGCTGCCCATGGGGCTGCAGG - Intergenic
1020083950 7:5300604-5300626 CAGCGTGCCCATGATCCTGGCGG + Exonic
1020353714 7:7253741-7253763 ACGGGTCCACATGAGGCTGCTGG - Intergenic
1023760657 7:43462445-43462467 CCAGGTGATCCTGATGCTGCTGG - Intronic
1024304174 7:47913047-47913069 TCAGGTGGTCATGATGCTGCTGG + Intronic
1025149839 7:56539502-56539524 CCTGGTGCCCAGGACTCTGCGGG - Intergenic
1033214397 7:139483267-139483289 CTGGGCGCCCATGGAGCTGCAGG - Exonic
1033746589 7:144323544-144323566 CCACGTGCCAAAGATGCTGCAGG - Intergenic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1034536585 7:151729349-151729371 CCTGGTGCCCATTGTTCTGCTGG - Intronic
1035462332 7:159049717-159049739 CCCGGCACCCATGAAGCTGCAGG - Intronic
1037623678 8:20589354-20589376 CCAGGTGATCTTGATGCTGCTGG - Intergenic
1038199807 8:25401388-25401410 CCGGGTGATATTGATGCTGCTGG + Intronic
1043550195 8:81362904-81362926 CCAGGTGATCTTGATGCTGCCGG + Intergenic
1043550297 8:81363939-81363961 CCAGGTGATCTTGATGCTGCTGG + Intergenic
1045183432 8:99811526-99811548 CCAGGTGCTGCTGATGCTGCTGG + Intronic
1049546440 8:143233847-143233869 CTGGGTGCTCATGAAGCTGGTGG - Intergenic
1053354359 9:37433663-37433685 CCAGATGCCACTGATGCTGCTGG + Intronic
1053462508 9:38281482-38281504 CCAGGTGCTCGTGATACTGCTGG - Intergenic
1060480620 9:124015036-124015058 CCAGGTGCCGCTGCTGCTGCGGG - Intronic
1060681187 9:125566524-125566546 TCTGTTGCCCATGCTGCTGCAGG - Intronic
1061093969 9:128443683-128443705 CCGTGTGCCCAAGGTGCAGCTGG + Intergenic
1062079952 9:134618571-134618593 CAGGGTGGACATGAGGCTGCGGG + Intergenic
1062365184 9:136205003-136205025 CCTGGTGGCCGCGATGCTGCTGG - Intronic
1062505997 9:136876867-136876889 CCTGGTGCCCCTGAGGCTGGAGG + Intronic
1062576730 9:137212323-137212345 CCCGGTGCCCATCATCCTGCAGG + Intronic
1203582551 Un_KI270746v1:24858-24880 TCAGGTGACCCTGATGCTGCTGG + Intergenic
1185778410 X:2824592-2824614 CCAGGTGACGCTGATGCTGCCGG + Intergenic
1186750259 X:12614414-12614436 CCAGGTGCTGCTGATGCTGCTGG - Intronic
1188560335 X:31461314-31461336 CCAGGTGTTCATGATGCTGCTGG - Intronic
1188803295 X:34557978-34558000 CCAGGTGCTCCTGATGCTGCTGG + Intergenic
1189741498 X:44121690-44121712 CCAGGTGGCGTTGATGCTGCTGG + Intergenic
1194753730 X:97712849-97712871 CCAGGTGACGCTGATGCTGCTGG + Intergenic