ID: 1121522845

View in Genome Browser
Species Human (GRCh38)
Location 14:94598258-94598280
Sequence CTGTGGAGATGGAGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 1, 1: 0, 2: 6, 3: 85, 4: 816}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121522839_1121522845 2 Left 1121522839 14:94598233-94598255 CCATCACAAATGTTAAGGTACAA 0: 1
1: 0
2: 0
3: 12
4: 167
Right 1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG 0: 1
1: 0
2: 6
3: 85
4: 816
1121522837_1121522845 14 Left 1121522837 14:94598221-94598243 CCTTATCTTGATCCATCACAAAT 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG 0: 1
1: 0
2: 6
3: 85
4: 816

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121522845 Original CRISPR CTGTGGAGATGGAGAGTGGG TGG Intronic
900146142 1:1159608-1159630 CTGTGGACATGGAGAGTGGCGGG - Intergenic
900150262 1:1175616-1175638 CTGTGGTGATGGTGACTGTGGGG - Intronic
900154983 1:1200329-1200351 CTGTGGGGATGGAGGGTGTGTGG - Intergenic
900606047 1:3524012-3524034 CTGTGGACATGGAGAGGCAGAGG - Intronic
900821556 1:4893482-4893504 ATGGGGAGGTGGGGAGTGGGTGG - Intergenic
900870933 1:5302266-5302288 CTGTGGACTTGGACAGTTGGGGG - Intergenic
900956885 1:5891834-5891856 CTGTGGGGCTGGAGCCTGGGTGG - Intronic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901654243 1:10760234-10760256 CTCTGGAGATGGAGAAAGGCTGG + Intronic
901855134 1:12039573-12039595 CAGTGGAGAAGGGGAGAGGGAGG + Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902376718 1:16033308-16033330 CTGGGGAGATGGGGAGGTGGGGG + Intronic
902772581 1:18654197-18654219 GTGTGGAGCTGGCGGGTGGGGGG - Intronic
903081180 1:20814778-20814800 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903519251 1:23934976-23934998 CTGTGGGGAGGGGGAGGGGGAGG - Intergenic
903670243 1:25031156-25031178 CTGGAGAGATGGAGACTGGAGGG + Intergenic
903680430 1:25092882-25092904 CTGTGGAGATGTAGGGTGTGTGG - Intergenic
904012160 1:27395916-27395938 CTGGGGAGCTGGACAGAGGGTGG + Intergenic
904077164 1:27852156-27852178 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
904183909 1:28687724-28687746 CAGTGGAGATAGAGACAGGGAGG + Intronic
904267365 1:29325576-29325598 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
904585592 1:31578057-31578079 GCTTGGAGATGGGGAGTGGGAGG - Intronic
904599862 1:31667407-31667429 CTGTGGAGGTGGAGGCTGTGAGG - Intronic
904784951 1:32975838-32975860 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
904842844 1:33384644-33384666 CCAGGGAGATGGAGAGTGAGGGG - Intronic
905175667 1:36134041-36134063 CTGTGGGAAGGGGGAGTGGGGGG - Intergenic
905427180 1:37895498-37895520 CTGTGGGGAGAGAGAGAGGGAGG - Intronic
905927493 1:41762377-41762399 CTCTGCTGATGGAGAATGGGAGG - Intronic
906404261 1:45529058-45529080 TTGTGGAGATGGTGAAGGGGTGG - Intergenic
907262126 1:53227011-53227033 GTGTGGACATGGGGGGTGGGTGG - Exonic
907538205 1:55185064-55185086 CTGGGGAGCTGGGAAGTGGGAGG - Intronic
907855686 1:58301220-58301242 ATGTGGGGGTGGAGAGGGGGGGG + Intronic
907946182 1:59138657-59138679 CTGTGGATGTGCAGAGTTGGAGG + Intergenic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
909554919 1:76942796-76942818 CTGTGGAGGTGGAGAATGACAGG - Intronic
909928990 1:81473127-81473149 AGGTGATGATGGAGAGTGGGTGG + Intronic
910598856 1:89008995-89009017 CTGAGAAGATGGAGAGGGAGAGG - Exonic
911385991 1:97176350-97176372 CTATGGAGATGGAGAAGGTGTGG + Intronic
911486864 1:98513622-98513644 CTGTGGGGAGGGAGAGGGAGAGG + Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913199158 1:116482286-116482308 ATGTGGTGAAGGAGAGTTGGAGG - Intergenic
913993592 1:143637086-143637108 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
914230805 1:145763897-145763919 ATGGGGAGAGGGAGAGGGGGAGG - Intronic
914990311 1:152494419-152494441 CTGTGGAGAGGGAGTGTGACAGG + Intergenic
915095624 1:153460255-153460277 CTGTGGAGCTGGAGCTGGGGAGG + Intronic
915140870 1:153767803-153767825 CTGTGTAGATGGAGGGCGTGAGG - Exonic
916053634 1:161052775-161052797 GTGGTGAGGTGGAGAGTGGGTGG - Exonic
916178203 1:162060513-162060535 GGGTGGAGGTGGAGAGTGGGAGG - Intergenic
916221815 1:162451807-162451829 CTGTATGGATGGAGAATGGGTGG - Intergenic
916420254 1:164631041-164631063 GTGTGGAGTGGGAGAATGGGAGG + Intronic
917474067 1:175353131-175353153 CTGTAGAGAGGCACAGTGGGAGG + Intronic
917563770 1:176188774-176188796 CTGAGGAGAGGAAGAGAGGGGGG - Intronic
917859721 1:179134717-179134739 CCGTGGAGAGGGAGAGGGAGAGG - Intronic
919614273 1:199785734-199785756 CTGTAGAGATGGGGATTGGAGGG + Intergenic
919664438 1:200278729-200278751 CAGTAGAGATAGAGAGAGGGAGG + Intergenic
919751018 1:201038309-201038331 CTGTGGAGAGGCAGAGAGAGGGG + Intergenic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
920171599 1:204075306-204075328 CGGGGGAGAGGGAGAGCGGGAGG - Intronic
920295619 1:204954421-204954443 CTGGGTAAATGGAGAGTGGGGGG + Intronic
920308754 1:205035685-205035707 CTGTGGATCTGGAGAGTGAATGG + Intergenic
920603687 1:207357544-207357566 CGGTGGGAATGGAGACTGGGCGG + Intronic
920866896 1:209760429-209760451 CTCTGGACAAGGAGGGTGGGTGG + Intronic
920951819 1:210579132-210579154 CACGGGAGATGGAGGGTGGGAGG + Intronic
920989473 1:210922878-210922900 ATGAGGAGGTGGAGAGTAGGTGG - Intronic
921155948 1:212438955-212438977 CTGAGAAGGTGGAGGGTGGGTGG - Intronic
921192604 1:212724200-212724222 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
921432068 1:215077356-215077378 CTTTGGATGTGGGGAGTGGGTGG - Intronic
922083182 1:222318209-222318231 ATGTGGAGAAGGAGGGCGGGCGG - Intergenic
922699571 1:227750902-227750924 CTGTGTAGAGGGAGATTGGGAGG + Intronic
923018055 1:230142153-230142175 CTGTGGAGGTGGGGGGAGGGTGG + Intronic
923064864 1:230508325-230508347 CTGTTTAGATGCAGAGTGGGTGG + Intergenic
923144986 1:231191465-231191487 GTGTTGAGATGGTGGGTGGGGGG + Intronic
923637407 1:235713601-235713623 CTGGGGGGATGGGGTGTGGGTGG + Intronic
923666508 1:236002986-236003008 CTGGGGAGAGTGAGAGAGGGAGG - Intronic
923716534 1:236429179-236429201 CTGTGCAGAGGGAGAGGGAGCGG + Intronic
924609319 1:245560794-245560816 CTGTGGGGACAGAGAGTGAGGGG - Intronic
924662696 1:246036376-246036398 CTCTGGAGAAGGAGACTGCGGGG - Intronic
924692098 1:246362446-246362468 CCGTGGAGAGGGAGAGGGAGAGG - Intronic
924946610 1:248850845-248850867 CTCTGGTGAGGGACAGTGGGTGG - Intronic
1063220921 10:3967056-3967078 CTGGGGCGAAGGAGAGAGGGTGG - Intergenic
1064201017 10:13284948-13284970 CTGCTCAGATGCAGAGTGGGAGG - Intronic
1065030653 10:21582655-21582677 TAGTGGAGATGGAGAGAGAGAGG + Intronic
1065103397 10:22354463-22354485 CTGTGGTGATGTAGAGTGCTAGG + Intronic
1065221586 10:23501435-23501457 ATGTGAGGGTGGAGAGTGGGAGG - Intergenic
1065287995 10:24203555-24203577 CTGTGGAGGTGGGGGTTGGGGGG - Intronic
1065886825 10:30085671-30085693 CAGTGGAGATGGGGAGTGATAGG + Intronic
1066345347 10:34579816-34579838 GTCAGGAGTTGGAGAGTGGGTGG - Intronic
1066390750 10:34975949-34975971 GTGGGGAGATGGAGAGGGAGAGG - Intergenic
1066654603 10:37686503-37686525 CTGGGGAGATAGAGTGAGGGAGG + Intergenic
1067391419 10:45866400-45866422 GTGGGGAGAGGGAGAGTGAGAGG + Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067563751 10:47322147-47322169 CTGGGGAGATGGGGAGAGTGTGG - Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067804796 10:49385142-49385164 CTATGGGGTTGGGGAGTGGGGGG + Intronic
1067850373 10:49750512-49750534 CTGTGGACAAGGAGAGGTGGAGG - Intronic
1067871871 10:49969751-49969773 GTGGGGAGAGGGAGAGTGAGAGG - Intronic
1067937048 10:50622265-50622287 CTGTGCAGAAGGGGAGAGGGCGG - Intronic
1068344402 10:55754716-55754738 CTGGGAAGCTGGAGGGTGGGAGG + Intergenic
1068405619 10:56585144-56585166 CTGAGAAGGGGGAGAGTGGGAGG - Intergenic
1070311342 10:75276053-75276075 CAGTGGAGAAGCAGAGCGGGGGG + Intergenic
1070331130 10:75418096-75418118 AGAGGGAGATGGAGAGTGGGAGG - Intergenic
1070630206 10:78079344-78079366 GTGTGGGGGTGGGGAGTGGGTGG + Intergenic
1070711209 10:78684510-78684532 CTGTGGAGCTAGGGGGTGGGAGG + Intergenic
1071025573 10:81108816-81108838 CTGTGGTGATGGGGAGAGTGAGG - Intergenic
1071152705 10:82653448-82653470 CTGTGGAAATGCAGATTGAGGGG + Intronic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071553770 10:86586686-86586708 TAGAGGAGATGGACAGTGGGCGG + Intergenic
1071954462 10:90743069-90743091 CTGTGGAGGTGCAGAGTCAGGGG - Intronic
1072003410 10:91220133-91220155 TTGTGGAGGTTGAGGGTGGGGGG - Exonic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1072652647 10:97307657-97307679 GTGGGAAGAAGGAGAGTGGGAGG + Intergenic
1072766445 10:98098441-98098463 CTGAGGAGAGTGAGAGTGGTGGG - Intergenic
1072956301 10:99891173-99891195 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1073002327 10:100294887-100294909 CCGTGGAGCTGGAGGGTGAGGGG + Intronic
1073263689 10:102209915-102209937 CTGTGGAGAGGGAAACTTGGGGG - Intergenic
1073559318 10:104483248-104483270 TTGTGGAGATGGAGTGTCGCTGG + Intergenic
1074864410 10:117536548-117536570 CTCTCGGGATGGAGGGTGGGTGG - Intergenic
1075135777 10:119784857-119784879 CTGGGGAGCTGGAGTTTGGGAGG - Intronic
1075137377 10:119796065-119796087 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1075407468 10:122204170-122204192 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1075842615 10:125517752-125517774 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1076011926 10:126995671-126995693 CCGTGGAGAGGGAGAGGGAGAGG + Intronic
1076598724 10:131643291-131643313 CCGTGGGCATGTAGAGTGGGTGG - Intergenic
1076766599 10:132638260-132638282 CTGCTGTGATGGAAAGTGGGAGG - Intronic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1076828000 10:132979914-132979936 CTGTGGTGATGGTCAGTGGCAGG - Intergenic
1076914506 10:133415176-133415198 CCGTGGAGAGGGAGAGGGAGCGG + Intronic
1077067125 11:646556-646578 CTGTGCAGATGGAGGGAGAGAGG + Intronic
1077254237 11:1573279-1573301 GGGTGGAGAGGGAGCGTGGGGGG + Intergenic
1077680598 11:4237161-4237183 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1077684876 11:4282559-4282581 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1077690314 11:4335371-4335393 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1078558088 11:12347076-12347098 CGGTGGAGACAGAGATTGGGAGG - Intronic
1079068553 11:17321233-17321255 GTGTGGAGTTGGGGAGTGGTGGG - Intronic
1079287944 11:19156735-19156757 TTGTGGAGATGGAGACAGGCAGG - Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080639339 11:34149712-34149734 CTCTTGAGAGGGTGAGTGGGGGG - Intergenic
1080686430 11:34519222-34519244 ATGTGAAGATGGAGCATGGGAGG + Intergenic
1080787981 11:35493440-35493462 CTGGATAGATGGAGAGAGGGAGG - Intronic
1081622018 11:44624265-44624287 GTGTGGAGGTGGGGAGTGGAAGG + Intergenic
1081628133 11:44667658-44667680 CTGTGGAGCAGGAGAGTGCGTGG - Intergenic
1081763026 11:45590497-45590519 CAGGGGAGGTGGAGGGTGGGTGG - Intergenic
1082696280 11:56369005-56369027 TTGTGTAGGTGGAGATTGGGAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083116445 11:60464249-60464271 TGGGGGAGATGGAGAGGGGGTGG - Intronic
1083130527 11:60621360-60621382 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1083142594 11:60734072-60734094 TTGTAGAGATGGCGGGTGGGGGG - Intronic
1083742107 11:64716539-64716561 CCGTGTGGAGGGAGAGTGGGAGG + Intronic
1084258193 11:67956571-67956593 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1084557927 11:69885841-69885863 GTGGGGAGATGGAGAGTGATCGG + Intergenic
1084795603 11:71502607-71502629 CTGTTGTGATAGAGAGTGGGGGG + Intronic
1085097623 11:73774375-73774397 ATGGGGAGAGGGAGAGGGGGAGG - Intergenic
1085231424 11:74974551-74974573 CTGTGGAGATGGTAAATGGTTGG - Intronic
1086341365 11:85852357-85852379 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1086570339 11:88276570-88276592 CTGTGGAGAGGGGTAGCGGGGGG - Intergenic
1086642095 11:89171740-89171762 CTTAGGAGATGGAGAATGGATGG - Intergenic
1087448915 11:98292519-98292541 ATGGGGAGATGGAGTTTGGGGGG - Intergenic
1087777742 11:102272024-102272046 GTAAGGAGATGAAGAGTGGGGGG + Intergenic
1088532335 11:110824189-110824211 CTGTGAGGATGGAAAGTGAGTGG - Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089416720 11:118298223-118298245 CTGGGTAGATGGTGACTGGGTGG - Intergenic
1089561108 11:119343623-119343645 CTGGGGACAGGGAGAGTGTGGGG + Intronic
1089679538 11:120111559-120111581 CTCTGGCGATGGAGTGTGGCTGG - Exonic
1090657125 11:128854634-128854656 CTCTGGACATGCACAGTGGGAGG - Intronic
1091533143 12:1379479-1379501 CTTTGGAGCTGGGTAGTGGGCGG - Intronic
1091545643 12:1499798-1499820 CTGTGGAGACCGAGACTGAGGGG - Intergenic
1092138451 12:6166418-6166440 CTGTGGAGAGGGAGCATGGAAGG - Intergenic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092806283 12:12226029-12226051 CTGTGTAGACGGGGAGAGGGAGG - Intronic
1092890375 12:12964253-12964275 CTGTGCCCATGCAGAGTGGGAGG + Intergenic
1092921374 12:13234521-13234543 ATGTGGAGAAGGAGAATGTGTGG - Intergenic
1093927667 12:24925573-24925595 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1094483929 12:30909030-30909052 CTGTGGACCTTGACAGTGGGTGG + Intergenic
1094718654 12:33038740-33038762 CTTTGGAGATGGAGAAAGGAAGG - Intergenic
1095068999 12:37815893-37815915 CCGTGGAGACGGAGAGGGAGAGG + Intergenic
1095582144 12:43812830-43812852 TTGTAGAGATGGGGAGTGGGAGG - Intergenic
1095589351 12:43886779-43886801 TTCTGGGGATGGAGGGTGGGAGG - Intronic
1095891183 12:47236027-47236049 CCCTGGTGATGGAGAATGGGAGG - Exonic
1096242747 12:49968023-49968045 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
1096693024 12:53332850-53332872 CTGGGCAGAGGGAGAGGGGGCGG - Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096882295 12:54682908-54682930 CTCAGGAGAGGAAGAGTGGGAGG - Intergenic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097028717 12:56076732-56076754 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1097123668 12:56755564-56755586 CTGAGGAGAGGGAGAGAGAGAGG + Intronic
1097243564 12:57592403-57592425 CTGTGGAGATGGAAGTTGTGAGG + Intronic
1098237513 12:68431718-68431740 CTGCAGAGAAGGAGAGAGGGAGG - Intergenic
1099080200 12:78169153-78169175 CAGTGGAGATGGAGATGGAGTGG + Intronic
1100392591 12:94156999-94157021 CTGTTAAGATGTACAGTGGGAGG - Intronic
1100729903 12:97453440-97453462 CTGTAGAGATGGATAGTCTGTGG - Intergenic
1100837570 12:98581210-98581232 CTGTGGGGCAGGAGAGTGGTGGG + Intergenic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1101324838 12:103706459-103706481 CTGTGATGCTGGAGAGTGGGAGG - Intronic
1101885014 12:108655369-108655391 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1101930313 12:109008373-109008395 CTGGGGAGATGGGGTGTGAGGGG + Intronic
1101941173 12:109100160-109100182 CTCTGGAGTGGGAGAGTGGGAGG - Intronic
1102020250 12:109677357-109677379 CCATAGTGATGGAGAGTGGGTGG - Intergenic
1102590186 12:113950890-113950912 GTGTGGCCATGGAGAGGGGGAGG - Intronic
1102749180 12:115277268-115277290 CGGGGGAGAAGGAGAGGGGGAGG + Intergenic
1103436314 12:120929535-120929557 CTGTGGAGATGGAATATGAGTGG - Intergenic
1103566293 12:121817469-121817491 CTCTGGAGCTGGACAGTGGTGGG + Exonic
1103594924 12:122019080-122019102 ATGAGGAGAAGGAGAGAGGGAGG - Intergenic
1104882505 12:132082348-132082370 CTGTGGAGGGAGAGACTGGGGGG + Intergenic
1104926174 12:132315062-132315084 CTGAGGAGCGGGAGACTGGGCGG + Intronic
1104992171 12:132631869-132631891 CTGTGGGGATGGAGCCTGTGAGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1106560379 13:30840578-30840600 CCGTGGAGACGGAGAGGGAGAGG + Intergenic
1107127864 13:36863905-36863927 CTGAGGACATGGAGAGTGTGTGG - Intronic
1107185295 13:37511218-37511240 CTGTGGTGATGGTGATGGGGTGG - Intergenic
1107714015 13:43180662-43180684 CCGGGCAGATGGAGCGTGGGTGG - Intergenic
1107853885 13:44595942-44595964 CTGAGGACAAGGAGAGTGGCAGG + Intergenic
1108454029 13:50595664-50595686 CTGAGGGGATGGCAAGTGGGTGG + Intronic
1108845892 13:54678231-54678253 CTGAGGGGTTGGAGAGAGGGAGG - Intergenic
1109273872 13:60283099-60283121 CTAGAGAGATGGAGAGAGGGAGG - Intergenic
1111388427 13:87561028-87561050 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1111388435 13:87561055-87561077 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111775801 13:92659891-92659913 CTGTGGCAAGGCAGAGTGGGAGG + Intronic
1112577820 13:100652666-100652688 CTGTGTTTATGCAGAGTGGGAGG - Intronic
1113406563 13:110046316-110046338 CTGTGGAGAGGGGGAGTAGGAGG + Intergenic
1113574186 13:111382582-111382604 CTGTGGTGATGGAGGTGGGGTGG + Intergenic
1113804849 13:113106734-113106756 GTGTGGGGATGGCGAGTGGGGGG + Intronic
1114042210 14:18689414-18689436 CTGGGGAAAGGGAGTGTGGGAGG + Intergenic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114578589 14:23736315-23736337 CTGTGGAGAGGGAGACGGAGAGG - Intergenic
1115727862 14:36236837-36236859 CTGTGGGGAGGGGGAGTGAGGGG + Intergenic
1117251661 14:53946104-53946126 CTTTGGAGAGGGAGTGGGGGCGG + Intergenic
1117953784 14:61107448-61107470 TTTTGGAGATGAAGCGTGGGTGG - Intergenic
1118300355 14:64609732-64609754 CAGAGGAGTTAGAGAGTGGGAGG - Intergenic
1118428796 14:65693527-65693549 GTGGGGAGAGGGAGAGAGGGAGG + Intronic
1118517909 14:66546784-66546806 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1118584532 14:67340682-67340704 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1119698101 14:76730119-76730141 CTGTGGCCAAGGAGAATGGGAGG + Intergenic
1119776846 14:77254231-77254253 CGGTGGAAATGCGGAGTGGGCGG + Intronic
1119835572 14:77746927-77746949 CCGTGGAGAGGGAGAGGGAGAGG - Intronic
1120049353 14:79847234-79847256 GTGTGGAGATGGAGATTGGAAGG - Intronic
1120255005 14:82107378-82107400 CTGGAGAGATGGAAAGTGGGAGG + Intergenic
1121098398 14:91233628-91233650 GTGAGGACATGGAGGGTGGGAGG - Exonic
1121225722 14:92320495-92320517 CTGTGGGGTTGGGGAGGGGGCGG + Intergenic
1121291629 14:92780347-92780369 CTTTGAACATGGAGTGTGGGTGG - Intergenic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1122606215 14:102948623-102948645 CTGTGGAGAGGGGGAGTGGGGGG + Intronic
1123114913 14:105890273-105890295 GTGTGCAGATGGGGGGTGGGGGG + Intergenic
1123685525 15:22794593-22794615 CTGTGGAGATGTGGAGGGGAAGG + Intronic
1124011599 15:25843624-25843646 CTGAGTAGATGGAGTCTGGGAGG - Intronic
1124058131 15:26261341-26261363 CTGTTGATATGGTGGGTGGGAGG - Intergenic
1124485783 15:30114396-30114418 CTGTGGAGATGGTGTGGGAGTGG + Intergenic
1124517792 15:30382872-30382894 CTGTGGAGATGGTGTGGGAGTGG - Intronic
1124540861 15:30583382-30583404 CTGTGGAGATGGTGTGGGAGTGG + Intergenic
1124547548 15:30645118-30645140 CTGTGGAGATGGTGTGGGAGTGG + Intronic
1124702762 15:31931167-31931189 CTGAGCACATGGAGAGTGGGTGG - Intergenic
1124757797 15:32424198-32424220 CTGTGGAGATGGTGTGGGAGTGG - Intergenic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125384388 15:39121898-39121920 TTGTGCAGATGGAGACAGGGAGG + Intergenic
1125793539 15:42387755-42387777 CTGGCGCTATGGAGAGTGGGTGG + Exonic
1125860288 15:42992731-42992753 CTTTGGAGCTAGAAAGTGGGAGG - Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126470874 15:49009379-49009401 CTGTGGAGATGTGGAGTGAAGGG + Intronic
1127166510 15:56249436-56249458 CTGGGGAGAGAGAGAGAGGGAGG + Intronic
1127478630 15:59357818-59357840 CTGACGGGATGGAGAGGGGGAGG + Intronic
1128315183 15:66655321-66655343 CAGTGGATGTGGGGAGTGGGAGG + Intronic
1128322144 15:66701579-66701601 GTGGGGAGATGGAGAGGGTGGGG - Intergenic
1128375873 15:67075428-67075450 CTGGGGAGCAGGAGAGGGGGAGG + Intronic
1128757102 15:70190508-70190530 CTGTGGAGATGGCGGGACGGGGG + Intergenic
1129007612 15:72387305-72387327 CTCTGGAGAGGGATATTGGGTGG + Intergenic
1129236993 15:74229678-74229700 CTGTGGAGAGGGAGGGTTTGGGG + Intergenic
1130367659 15:83254676-83254698 CTGTGAATATGGAGAGTTGGTGG + Intergenic
1132038756 15:98506902-98506924 CTGAGGAAATGGGCAGTGGGCGG + Intronic
1132151948 15:99468109-99468131 CTGTGGTGTTGGAGACAGGGAGG + Intergenic
1132189712 15:99842321-99842343 CTGTGGCAAGGCAGAGTGGGAGG - Intergenic
1132299524 15:100767432-100767454 GAGGGGAGATGGAGAGAGGGAGG - Intergenic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1132622958 16:876311-876333 CCGTGGAGACGGAGGGTCGGCGG + Intronic
1132775327 16:1590512-1590534 TTGTGGAGGTTGAGAGAGGGAGG - Intronic
1133129347 16:3667002-3667024 CACTGGGGATGGAGTGTGGGAGG - Intronic
1133164596 16:3937680-3937702 CTCTGGAGATGGAGCTGGGGTGG + Intergenic
1133641041 16:7717586-7717608 GTGTGAAGATGGGGGGTGGGGGG + Intergenic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1134013783 16:10874427-10874449 GTGTGGGGATGGAGAGGGAGGGG - Intergenic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1135030604 16:19035274-19035296 GAGTGGAGAGGGAGAGAGGGAGG + Intronic
1135609019 16:23848595-23848617 CAGTGGAGAGGGAGAGGGAGTGG - Intronic
1135698601 16:24611679-24611701 CAGTGGAGATGGACAGGGAGAGG + Intergenic
1135748469 16:25037290-25037312 CTGTAGAAAGGGAGAGTGAGTGG - Intergenic
1135985254 16:27179248-27179270 CTGTGGAGATGGGAAGATGGAGG + Intergenic
1136155010 16:28376714-28376736 CTGTGGGGAGGGAGAGGGAGAGG - Intergenic
1136208082 16:28738548-28738570 CTGTGGGGAGGGAGAGGGAGAGG + Intergenic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136456979 16:30385653-30385675 TTGTGGGGAGTGAGAGTGGGAGG - Intronic
1136543408 16:30941836-30941858 CTGTGGGCAGGCAGAGTGGGGGG + Intronic
1137808251 16:51328483-51328505 CAGGGGAGATGGTGGGTGGGGGG - Intergenic
1137875271 16:51990708-51990730 CTCAGGAGATGGAGGGTAGGAGG - Intergenic
1137939662 16:52671392-52671414 GTGTGGAGATAGAGATTGTGTGG - Intergenic
1137939663 16:52671409-52671431 GTGTGGAGATAGAGATTGTGTGG - Intergenic
1139054585 16:63167019-63167041 CTTTGGAGCTGGAAAATGGGTGG + Intergenic
1139670138 16:68487277-68487299 CTGGGGACATGGAGAGTGGGTGG - Intergenic
1139793104 16:69456751-69456773 CTGTGGAAATGAAGACTGGGGGG + Intronic
1140197445 16:72866826-72866848 CTGTGTGGATGGTGAATGGGTGG - Intronic
1141074776 16:80994697-80994719 CAGTGGTGATGGACAGTGGTAGG + Intronic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1142006578 16:87692212-87692234 CTGTGGGGAGGGAGACGGGGAGG - Intronic
1142344517 16:89545462-89545484 CTGTTGGGATGGAGAGTGAAGGG + Intronic
1143141286 17:4743282-4743304 CTCTGGAGAAGGAGAAGGGGAGG - Exonic
1143399893 17:6637303-6637325 CTGTGGAGAAGGAGACACGGTGG - Intronic
1143436724 17:6934161-6934183 TTGTGAGGGTGGAGAGTGGGAGG - Intronic
1143481121 17:7227888-7227910 CTGTGGTCATGGGGAATGGGTGG - Intronic
1143483132 17:7238509-7238531 CTGTGGAGAGAGAGAGAGAGTGG - Intronic
1143519603 17:7437922-7437944 CTGGAGAGATGGAGGATGGGGGG - Intergenic
1143538769 17:7557550-7557572 CTAGTGAGGTGGAGAGTGGGCGG - Exonic
1143949205 17:10619454-10619476 TTTTGGAGATGGAAAGTGGTGGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144356570 17:14452221-14452243 TGGGGGAGATGGAGAGTGAGGGG + Intergenic
1144966093 17:19078079-19078101 CTGGGTGGATGGGGAGTGGGTGG + Intergenic
1144966110 17:19078139-19078161 CTGGGTAGATGGATACTGGGTGG + Intergenic
1144966187 17:19078345-19078367 CTGGGTAGATGGGGACTGGGTGG + Intergenic
1144966233 17:19078477-19078499 CTGGGTAGATGGATACTGGGTGG + Intergenic
1144981685 17:19173580-19173602 CTGGGTAGATGGATACTGGGTGG - Intergenic
1144981731 17:19173712-19173734 CTGGGTAGATGGGGACTGGGTGG - Intergenic
1144981859 17:19174050-19174072 CTGGGTAGATGGATACTGGGTGG - Intergenic
1144981875 17:19174110-19174132 CTGGGTGGATGGGGAGTGGGTGG - Intergenic
1144986348 17:19204129-19204151 CTGGGTGGATGGGGAGTGGGTGG + Intergenic
1144986365 17:19204189-19204211 CTGGGTAGATGGATACTGGGTGG + Intergenic
1144986493 17:19204527-19204549 CTGGGTAGATGGGGACTGGGTGG + Intergenic
1144986539 17:19204659-19204681 CTGGGTAGATGGATACTGGGTGG + Intergenic
1145084511 17:19925450-19925472 TTGTGGAGGTGGGGAGTAGGAGG - Intronic
1145209531 17:21003074-21003096 CTGTGGAGGCAGAGAGAGGGAGG + Intronic
1145864208 17:28229525-28229547 CTGTGTGGGTGGGGAGTGGGAGG + Intergenic
1146128383 17:30248284-30248306 CTGTGGAACTGGGGATTGGGTGG - Exonic
1146156683 17:30530285-30530307 CTGTGGAAAGGAAGAGTGCGTGG - Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146949314 17:36894697-36894719 CAGTGGTGATGGAGAGTGTTGGG - Intergenic
1147259234 17:39198747-39198769 CTGTGGAGCAGGAGAAGGGGTGG - Intergenic
1147438746 17:40433845-40433867 CTCTGGAGGTGGGGAGCGGGAGG + Intergenic
1147583240 17:41638491-41638513 CTGGGAAGGTGGAGGGTGGGAGG - Intergenic
1147624835 17:41893255-41893277 CTGTGGACATGGGGCGTGGAGGG - Intronic
1147746415 17:42697486-42697508 CTGTGGACAGTGAGAGTGGCAGG + Intronic
1147874492 17:43611460-43611482 CCTTGGAGCAGGAGAGTGGGTGG - Intergenic
1147888366 17:43699641-43699663 CTGTTGTGAAGGGGAGTGGGAGG + Intergenic
1148193686 17:45698205-45698227 TTGGGGAGATGGAGATGGGGAGG + Intergenic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1148353163 17:46956061-46956083 CCATAGAGATGGAGAGTGGGAGG + Intronic
1148357922 17:46988535-46988557 AAGAGGAGATGGAAAGTGGGAGG + Intronic
1148698495 17:49575120-49575142 CTGAGAAGCTGGAGAGTGAGGGG - Intergenic
1148744060 17:49908657-49908679 CTGTGGGAATGGGGAGTGGGCGG + Intergenic
1148749336 17:49935588-49935610 CTGTGGAGCTGGACAGCCGGGGG + Intergenic
1148758906 17:49989378-49989400 CTTTGGAGACGGAGAGCTGGAGG - Intergenic
1148768444 17:50053183-50053205 CTGGGGAGATGGAGTGGGAGTGG - Intergenic
1148797540 17:50204214-50204236 CTGGGGGGATGGGGGGTGGGAGG + Intergenic
1148865737 17:50627550-50627572 TCCTGGAGATGGGGAGTGGGCGG + Intergenic
1149114612 17:53077606-53077628 CTGTGGAAATTGTGAGGGGGTGG + Intergenic
1149415982 17:56460513-56460535 GTGTGGGGAAGGAGAGTGTGGGG - Intronic
1150530972 17:65981142-65981164 ATGTAGAGATGGAGAGTGCAAGG - Intronic
1151407998 17:73902036-73902058 CAGTGGAGATGGGGGGCGGGGGG - Intergenic
1151697108 17:75723338-75723360 CTGTGGCCAGGGACAGTGGGAGG + Intronic
1152230154 17:79110328-79110350 CAGAGGATGTGGAGAGTGGGAGG - Intronic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1153591056 18:6674530-6674552 CCCTGGGGATGGAGAGTGGTGGG + Intergenic
1153770931 18:8416039-8416061 GGGAGGAGATGGAGAGAGGGTGG - Intergenic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154327676 18:13403860-13403882 CTGTGATGATTGAGAGTGGCTGG + Intronic
1154974007 18:21439254-21439276 CTTTGGAGATGATGGGTGGGAGG - Intronic
1155228040 18:23747282-23747304 CCATGGAGTTGAAGAGTGGGAGG + Intronic
1155963638 18:32016664-32016686 CTATGGAGCTGGAGCATGGGTGG - Intergenic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157492445 18:48133808-48133830 CTGTGGAGATGAATAGAGGGAGG - Intronic
1157588770 18:48822472-48822494 GTGGGGAGATGAAGAGTGGTTGG - Intronic
1158224134 18:55182889-55182911 CTTGGGGAATGGAGAGTGGGAGG - Intergenic
1158477435 18:57792795-57792817 GTATGGAGATGGGGAGTGGCTGG + Intronic
1158512736 18:58106065-58106087 CTGTTGATGTGGAGAGTGAGAGG + Intronic
1158561355 18:58516472-58516494 TTGTGGAGAGGGAGAGGGGTGGG - Intronic
1159225171 18:65523835-65523857 CTGTGGAAATGGAGTGATGGTGG + Intergenic
1159270789 18:66147580-66147602 TTATGGAGATAGAGAGTGGAAGG - Intergenic
1160127468 18:76189597-76189619 ATGGGGAGATGGAAAGTGGATGG - Intergenic
1160205080 18:76824812-76824834 CTCTGGAGATGGAAAGAGGAGGG - Intronic
1161101557 19:2424398-2424420 ATGGGGAGATGGGGGGTGGGAGG - Intronic
1161655955 19:5515072-5515094 CTTTACAGATGGGGAGTGGGTGG - Intergenic
1162140169 19:8580717-8580739 CTGGGGGGATGGAGAGGGGCTGG - Exonic
1162453027 19:10766130-10766152 GTGAGGAGAGGGAGAGAGGGAGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163142874 19:15362366-15362388 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1163207383 19:15813650-15813672 GTGGGGAGATAGAGAGTGGGAGG + Intergenic
1163483724 19:17574183-17574205 CTGCGTAGATGGAGACTGGGTGG + Intronic
1164168706 19:22703853-22703875 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1164402324 19:27910751-27910773 CTTTGGAGTTGGAGGCTGGGGGG + Intergenic
1164458206 19:28426737-28426759 CTGTGGTGGTGGGGGGTGGGGGG - Intergenic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1164800163 19:31069318-31069340 CTGTGGAGAACGGGAGTGAGGGG + Intergenic
1165149625 19:33753359-33753381 GTGGGGAGATGGTGGGTGGGAGG - Intronic
1165798021 19:38530337-38530359 CTGGGGTGATGTGGAGTGGGGGG - Intronic
1165876040 19:39007578-39007600 CTGGGGAGATGCAGAGTTGGGGG - Intronic
1166050603 19:40256724-40256746 GCGGGGAGATGCAGAGTGGGAGG - Intronic
1166142684 19:40813418-40813440 CTGGGGAGATGGTGGGCGGGGGG + Intronic
1166293738 19:41878967-41878989 CTGTGGAGAGACAGGGTGGGTGG - Intronic
1166852153 19:45766181-45766203 CTGTGCAGCTGGAGGGCGGGCGG + Intronic
1167467900 19:49659716-49659738 CGGAGGTGAGGGAGAGTGGGTGG + Exonic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
1168658120 19:58146534-58146556 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
925055730 2:855639-855661 TTAGGGAGATGGAGAGTGGTTGG - Intergenic
925364208 2:3300384-3300406 CTGACGAGAAGGAGAGGGGGCGG - Intronic
926243706 2:11106648-11106670 TTGTAGAGATGGAGGGCGGGGGG - Intergenic
926663680 2:15496319-15496341 CTGGGGAGATGGAGTGTTGCAGG + Intronic
926675234 2:15613019-15613041 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
926885042 2:17589421-17589443 CTGTGCAGAAGGAGAGTGGTTGG + Intronic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
928445339 2:31329088-31329110 CAGTGGGGATGGAGAATGGGGGG + Intergenic
928450557 2:31374711-31374733 CTGCAGAGATGGAGTGTGGAGGG - Intronic
928687346 2:33762178-33762200 CTGGGGAGAGGGAGAGGGGGAGG + Intergenic
928946670 2:36778240-36778262 CTCTGGAGTAGGAGAGTGTGGGG - Intronic
929097615 2:38278842-38278864 CTGAGGAGAGGGAGAGTGATGGG + Intergenic
929143305 2:38685249-38685271 CTCTGGAAATGGAGCGGGGGTGG + Intronic
929238509 2:39629219-39629241 ATGGGGAGAGGGAGAGGGGGAGG + Intergenic
929562556 2:42964788-42964810 CTGTGGAGAGGGACAGAGAGGGG + Intergenic
930032269 2:47065755-47065777 CTGAGGGCAGGGAGAGTGGGTGG - Intronic
930665759 2:54096845-54096867 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931514358 2:63036407-63036429 CTGTGGAGAAGGGAAGTGTGGGG + Intronic
931576226 2:63721723-63721745 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
931604917 2:64042472-64042494 CCGTGGAGAGGGAGAGGGAGGGG + Intergenic
931777650 2:65554163-65554185 CAGTTGAGGTGGAGAGTGGTAGG + Intergenic
931980825 2:67692524-67692546 CAGAGGAGATGGTGAGTGGATGG + Intergenic
932253962 2:70267774-70267796 CCGTGGAGAGGGAGAGGGGGAGG + Intronic
932396967 2:71455006-71455028 CTGGGGAGAAGGGGAGTGGCAGG - Intronic
932807709 2:74797041-74797063 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
932851587 2:75192713-75192735 GTGAGGGGGTGGAGAGTGGGAGG + Intronic
932883607 2:75527416-75527438 CAGTGGAGAGGGGGAGGGGGAGG - Intronic
933799394 2:85948742-85948764 CTGTGGAGATGGAATAGGGGTGG + Intergenic
933841605 2:86291229-86291251 ATGAGGAGTAGGAGAGTGGGAGG + Intronic
934061654 2:88299844-88299866 CTGAGGAGAGGGAGAGAGAGAGG - Intergenic
934501763 2:94866854-94866876 GTGGGGAGAGGGAGAGAGGGAGG - Intergenic
934539821 2:95164672-95164694 TTATGGAGATGGAGAGTAGAAGG + Intronic
934953652 2:98597843-98597865 CTGTCAAGGTGGAGAGTTGGAGG + Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935498894 2:103814157-103814179 CTGTGGGCATGGTGAGTGTGGGG - Intergenic
935632213 2:105221406-105221428 GTGTGGAGGAGCAGAGTGGGGGG + Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936054500 2:109251555-109251577 GTGTGGAGATGGCGACTGGTGGG + Intronic
936233927 2:110726716-110726738 TTGTGGAGATGGGGGGTGGGGGG + Intergenic
936245218 2:110820543-110820565 CTGAGGAGAGGGAGTGGGGGTGG + Intronic
936267311 2:111020395-111020417 CTCTGGGGATGGAGAGCTGGTGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936899904 2:117470701-117470723 CTGTGGTGGTGGTGGGTGGGGGG + Intergenic
936978403 2:118241656-118241678 CTGGGGCCATGGAGGGTGGGTGG + Intergenic
937168934 2:119845229-119845251 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937421014 2:121755521-121755543 CAGAGGAGAGGGAGAGTGGGCGG - Exonic
937472827 2:122188580-122188602 AAGTGGAGATGGAAATTGGGTGG + Intergenic
937511058 2:122595367-122595389 ATATGGAGATGGTGGGTGGGTGG - Intergenic
938187215 2:129242561-129242583 ATTTGGAGAGTGAGAGTGGGAGG + Intergenic
938268005 2:129943117-129943139 CTGGGGAAAGGGAGTGTGGGAGG - Intergenic
938366204 2:130736583-130736605 CAGGGGAGAGGGAAAGTGGGAGG - Intergenic
938990238 2:136620571-136620593 TTTTGGGGGTGGAGAGTGGGAGG + Intergenic
939631789 2:144534445-144534467 CTTTGGGGATGCAGGGTGGGAGG - Intergenic
939710179 2:145507730-145507752 CTATGGACATAGAGAGTAGGAGG - Intergenic
939733698 2:145817221-145817243 CTGTGGGGTTGGGGAGAGGGGGG - Intergenic
941316927 2:164004762-164004784 CTATGGACATAGAGAGTAGGAGG + Intergenic
942034011 2:171993121-171993143 GAGTGGAGGTGGAGAGTGGGAGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
945825692 2:214717439-214717461 CTGTGGAGGTGGCGGATGGGAGG - Intergenic
946419075 2:219554746-219554768 CGGGGGAGATGGAGAGAGGGAGG + Intronic
946750864 2:222895320-222895342 CTCTGGAGGAGGAGAGAGGGTGG - Intronic
946751639 2:222897907-222897929 CCGTGGAGAGGGAGAGGGGGAGG + Intronic
946902712 2:224387725-224387747 GGGTGGAGCTGGAGAATGGGAGG + Intronic
947001611 2:225463762-225463784 CTGGGGTGATGAAGAGTGGCAGG + Intronic
947536430 2:230942785-230942807 GGGTGGGGGTGGAGAGTGGGGGG - Intronic
947541826 2:230985176-230985198 CTTTGGAGATGAAGGGAGGGAGG + Intergenic
947773057 2:232686270-232686292 CGCTGGAGATGGAGGGTGGGAGG - Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948751943 2:240138028-240138050 CTGTAGAGAAGGGGAGTGGGGGG + Intergenic
948765656 2:240217470-240217492 CGGTGGAGGTGGACGGTGGGTGG - Intergenic
948791889 2:240383503-240383525 CTGTGTGGATGGGGAGTGGCAGG - Intergenic
1169146397 20:3255285-3255307 CTGCAGAGATGGGGAGTGGAGGG + Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169469550 20:5871975-5871997 CTGTGGAGTAGGGGAGTGGTTGG - Intergenic
1169485196 20:6024495-6024517 CTGAGGAGAGGGAGAGTGATAGG - Intronic
1169927088 20:10794772-10794794 CTGGGGAGAAGGAGATTGAGAGG - Intergenic
1170010247 20:11714928-11714950 CTGTGCAGAGAGAGAGTAGGGGG + Intergenic
1170599744 20:17832051-17832073 CTGTGGGGATGAAGACGGGGCGG + Intergenic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171077843 20:22147262-22147284 CAGTGGAGATGGCAGGTGGGAGG - Intergenic
1171421817 20:25022771-25022793 CTGAGGAGCTGTAGGGTGGGAGG + Intronic
1171823613 20:29876186-29876208 CTCTGGAGCTGGAGAGCCGGGGG + Intergenic
1172051797 20:32123156-32123178 ATGAGGAGAGGGAGAGGGGGAGG + Intronic
1172209395 20:33186207-33186229 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173667483 20:44773311-44773333 CAGTGGAGATAGAGGGTCGGGGG - Intronic
1174117818 20:48239545-48239567 CTGTGGAAATGGCTAGTGGTTGG - Intergenic
1174344683 20:49921433-49921455 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1174582464 20:51581724-51581746 CTGTGGAGTCAGAGAGAGGGAGG - Intergenic
1174612201 20:51807146-51807168 CTGGAGGGAGGGAGAGTGGGGGG + Intergenic
1174744147 20:53045108-53045130 CTGTGGGCATGGAGTGTGAGTGG - Intronic
1174975528 20:55328853-55328875 CTGAGAAGATGGAGGGAGGGAGG - Intergenic
1175185992 20:57179903-57179925 CTGTGTAAATGGAGACTTGGTGG + Intronic
1175223801 20:57433289-57433311 CTGTGGAGCTGCAGAGGGGGAGG - Intergenic
1175281155 20:57804943-57804965 CTGTGGAGAGGGACTTTGGGTGG - Intergenic
1175495821 20:59413493-59413515 ACTTGGAGATGGAGTGTGGGTGG - Intergenic
1176348603 21:5771813-5771835 GTGGGGAGATGGAGAGGGTGAGG + Intergenic
1176355417 21:5892397-5892419 GTGGGGAGATGGAGAGGGTGAGG + Intergenic
1176496224 21:7552642-7552664 GTGGGGAGATGGAGAGGGTGAGG - Intergenic
1176542924 21:8169883-8169905 GTGGGGAGATGGAGAGGGTGAGG + Intergenic
1176561875 21:8352928-8352950 GTGGGGAGATGGAGAGGGTGAGG + Intergenic
1177067337 21:16456314-16456336 CTGTGGAGGTTGAGGGTGGGAGG - Intergenic
1177203484 21:17984077-17984099 CTGTGGAGAGGGAGAAATGGGGG - Intronic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178684951 21:34703371-34703393 CTGGTGAGAAGGAGAGTGTGGGG + Intronic
1178779081 21:35582355-35582377 TTGTGGAGATGCAGAGTTGCTGG - Intronic
1179033049 21:37736661-37736683 ATGGGGAGATGGAGAGAGGGAGG + Intronic
1179803176 21:43821578-43821600 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1179951500 21:44711270-44711292 CTGTGGAGATGGGCAGAGGCGGG - Intronic
1180046801 21:45310336-45310358 CTGTGGACATGCTGAGTGTGTGG - Intergenic
1180051754 21:45334900-45334922 CTGTGGGGGTGGCTAGTGGGGGG + Intergenic
1180861112 22:19083702-19083724 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1181361786 22:22343311-22343333 ATGGGGAGATGGAGGCTGGGAGG - Intergenic
1181374920 22:22449980-22450002 CTGTGGATTTGCTGAGTGGGAGG - Intergenic
1181662170 22:24359694-24359716 CTGTGGTGATGTTCAGTGGGAGG - Intronic
1181792491 22:25278634-25278656 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1182001065 22:26920218-26920240 CTGTGAAGATTCAGAGTGGGTGG + Intergenic
1182025923 22:27119181-27119203 TTTTGAAGGTGGAGAGTGGGAGG + Intergenic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182132626 22:27868282-27868304 CTTTTGAGATAGAGAGTGGCAGG - Intronic
1182300746 22:29335584-29335606 CTGTGGAAAGGGGGAGAGGGTGG - Intronic
1182321063 22:29478947-29478969 CTGAGAAGATGGGGAGGGGGAGG + Intergenic
1182357552 22:29729194-29729216 CCGTGGATGTGGAGAGTGAGTGG + Exonic
1183374195 22:37453564-37453586 CTGTGGAGATGCAGAGGCTGAGG - Intergenic
1183543593 22:38443808-38443830 ATGTGGAGATGGACTGCGGGAGG - Intronic
1183718284 22:39547085-39547107 CTGTGGGCATGGAGAGGGAGAGG + Intergenic
1183954544 22:41371494-41371516 GTCTGGAGATGGAGAGAGAGGGG - Intronic
1184111473 22:42398078-42398100 CCCTGGAGAGGGTGAGTGGGAGG - Intronic
1184145324 22:42607122-42607144 CTGGGGAGAGGGGGAGGGGGAGG - Intronic
1184330623 22:43824875-43824897 CTGAAGCGATGGAGAGTCGGGGG - Exonic
1184453829 22:44598088-44598110 AGGTGGAGATGGAATGTGGGAGG - Intergenic
1185072052 22:48661892-48661914 TTGGGGAGATGGTGACTGGGGGG + Intronic
1185363767 22:50425153-50425175 CTGTGGAGAGGGAGAATGAATGG - Intronic
949327870 3:2887384-2887406 GTGTGGAGAGTGAGGGTGGGGGG + Intronic
949586947 3:5450234-5450256 CTGGAGAGATGGAGTGTGCGAGG + Intergenic
949616542 3:5759972-5759994 TTGTGGGCAGGGAGAGTGGGCGG - Intergenic
949853154 3:8439035-8439057 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950726745 3:14921852-14921874 ATGCCGAGATGGAGGGTGGGAGG + Intronic
952184956 3:30958545-30958567 GTGTGGAGATGAAGGGAGGGAGG - Intergenic
952304092 3:32130130-32130152 CTGCGAACAGGGAGAGTGGGAGG + Intronic
952721826 3:36541646-36541668 CTCTGGAGAATGAGATTGGGAGG + Intronic
952894163 3:38065359-38065381 CTGTGCAGAGGGAGAGGGAGAGG + Intronic
952952985 3:38539160-38539182 CTGTGGAGCTGCCTAGTGGGAGG + Intronic
953239362 3:41134899-41134921 CTTTGGAGATGAAGACAGGGAGG + Intergenic
953924931 3:46978014-46978036 CAGTGGAGGTGGAGAGGGGGCGG - Intronic
953978035 3:47397053-47397075 CTGAGGAGAGGGAGAGAGGCAGG + Intronic
954481522 3:50804751-50804773 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
955190990 3:56761406-56761428 GTGTGTAGATGGACAGTGGCAGG - Intronic
955249379 3:57263388-57263410 GTGTGGGGATGGGGGGTGGGAGG - Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956674225 3:71719693-71719715 ATGTGGAGTTGAAGAGTGGTAGG + Intronic
956751246 3:72345691-72345713 GTGTGGGGATGGAGAGTGTCAGG - Intergenic
957073142 3:75581087-75581109 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
957715584 3:83926388-83926410 CTGCGGAGGAGGAGAGGGGGTGG - Intergenic
957792651 3:84959751-84959773 CTGGGGACAGGGAGACTGGGAGG - Intronic
958464662 3:94442991-94443013 CTGTGGAGAGCGGGAGTGGGGGG - Intergenic
960344735 3:116518644-116518666 CTGTGCAGAGGGAGAGGGAGAGG - Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961203141 3:125060103-125060125 CCTTGTAGATTGAGAGTGGGAGG - Intergenic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
961532209 3:127546834-127546856 CCGTGGAGACAGAGACTGGGAGG + Intergenic
961836207 3:129662174-129662196 CAGAGGAGATGGTGGGTGGGTGG + Intronic
961873454 3:130003892-130003914 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
962108787 3:132420237-132420259 CTGTGCAGATTGAGAGGGAGAGG + Intronic
962625366 3:137220587-137220609 CTGTGGGGAGGGGGAGGGGGAGG + Intergenic
963275322 3:143324281-143324303 CTGTGGGAATGGAGAGGGAGAGG - Intronic
963331425 3:143920242-143920264 TTGTGGAGATGGGGAAAGGGAGG - Intergenic
963700495 3:148619506-148619528 ATGTCTTGATGGAGAGTGGGAGG - Intergenic
963956565 3:151260928-151260950 CTGGGGAGATGGAAACTGGAAGG - Intronic
964695677 3:159505121-159505143 CAGATGAGATGTAGAGTGGGAGG + Intronic
964779138 3:160315716-160315738 CTGGGAATATGGAGAGTGGGAGG + Intronic
965396631 3:168166915-168166937 ATGTAGAAATGGAGAGTGGGAGG + Intergenic
966444569 3:179987309-179987331 ATGGGGAGAGGGAGAGAGGGAGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966760175 3:183410826-183410848 CTGTGGATTTAGAGAGTGGCTGG - Intronic
966783678 3:183607336-183607358 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
967333600 3:188317974-188317996 CTGTGTATCTGGAGTGTGGGAGG + Intronic
967421313 3:189276221-189276243 CTGTGAAGATGAAGAGGTGGTGG + Intronic
967924926 3:194638560-194638582 TTGTGGAGATGCAGTGTAGGAGG - Intergenic
967933272 3:194706008-194706030 ATGTGGAGATGGGCAGTGGTGGG + Intergenic
967943905 3:194787141-194787163 CTGTGGGAATGGAGAGGGAGGGG + Intergenic
968054215 3:195678777-195678799 CAGCAGAGAGGGAGAGTGGGCGG + Intergenic
968101674 3:195970365-195970387 CAGCAGAGAGGGAGAGTGGGCGG - Intergenic
968979079 4:3837045-3837067 CTGGGGAGATGGAGCTTGGTAGG - Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969446020 4:7245095-7245117 GTGTGGACAGTGAGAGTGGGCGG + Intronic
969873849 4:10121638-10121660 CTGTGCAGATGGGGAGGTGGAGG - Intergenic
970038176 4:11763781-11763803 GTGTGGAGGTGGGGGGTGGGGGG + Intergenic
970290761 4:14569642-14569664 ATGTGGAGGTGGAGGCTGGGAGG - Intergenic
970687613 4:18586556-18586578 CCCAGGAGATGGAGAGTGGAGGG + Intergenic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971197076 4:24479716-24479738 CTGTTGAGAGAGAGAGAGGGAGG - Intergenic
971485634 4:27157141-27157163 CAGTGGCTGTGGAGAGTGGGGGG - Intergenic
971693315 4:29866038-29866060 TTTTGGAAATGGAGAGTTGGAGG + Intergenic
971734033 4:30423060-30423082 ATTTGAGGATGGAGAGTGGGTGG - Intergenic
972242555 4:37208935-37208957 GTGTGGAGGTGGAGGGAGGGAGG - Intergenic
972552811 4:40148463-40148485 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
973907635 4:55546956-55546978 CTGGGGAAAGGGAGAGTGAGGGG - Intronic
974385527 4:61199974-61199996 GGGAGGTGATGGAGAGTGGGAGG + Intergenic
975063650 4:70036933-70036955 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976334852 4:83873580-83873602 CTGAGGAGATAAAGATTGGGTGG - Intergenic
976810983 4:89101029-89101051 CTGAGGAGAGGGAGAATGAGTGG + Intronic
977751433 4:100614383-100614405 ATATGGAGTTGGAGGGTGGGTGG - Intronic
978369405 4:108015561-108015583 CTGTGGGGTAGGAGAGAGGGAGG - Intronic
979482720 4:121237997-121238019 CTGTGGAAATCGGGAGAGGGAGG - Intergenic
979640563 4:123008886-123008908 GAATGTAGATGGAGAGTGGGGGG + Intronic
979915383 4:126426274-126426296 CTATGGAGATAGAGAGTAGAAGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980282342 4:130737620-130737642 CAGCACAGATGGAGAGTGGGAGG - Intergenic
980471866 4:133263239-133263261 CTGAGGGGAGGGAGAGGGGGCGG - Intergenic
980794474 4:137663177-137663199 CAGTGGGGATGGGCAGTGGGTGG - Intergenic
982467447 4:155748210-155748232 GTATGGAAATGGAGGGTGGGAGG - Intergenic
982547244 4:156749277-156749299 CAGTGGGCATGGAGAGTGGGGGG + Intergenic
984241038 4:177219485-177219507 CTGGGGAGAGGGAGAGGGAGAGG + Intergenic
984813889 4:183819557-183819579 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
984873103 4:184344769-184344791 CTGAGGAGGGGGCGAGTGGGAGG + Intergenic
984886430 4:184454148-184454170 CTGTGGATGTGGAGTGTGGGAGG - Intronic
985213490 4:187621762-187621784 TTGTATACATGGAGAGTGGGAGG - Intergenic
985218794 4:187681009-187681031 CTGTGGAGATAGGCAGTGGGAGG - Intergenic
985245437 4:187975791-187975813 CTCTGAGGGTGGAGAGTGGGAGG + Intergenic
985500517 5:241430-241452 CGGAAGAGAGGGAGAGTGGGCGG + Intronic
985520645 5:372659-372681 CGGTGCAGACGGAGGGTGGGAGG - Intronic
985736871 5:1588267-1588289 CGGAAGAGAGGGAGAGTGGGCGG - Intergenic
986851546 5:11818899-11818921 CTGTGGAGGTGATGAGTGGAGGG + Intronic
986996210 5:13610264-13610286 CTTTTGAGAGGGAGAGAGGGAGG + Intergenic
987058637 5:14220344-14220366 CTGAGGAGAGGGAGAGAGGCGGG - Intronic
987201385 5:15581348-15581370 GTGGGGAGATGGAGGATGGGCGG - Intronic
988609235 5:32710185-32710207 CTGTGGCTATGGCCAGTGGGAGG + Intronic
988998554 5:36737922-36737944 ATGTGGAGAAGGAGAGGTGGAGG - Intergenic
989021680 5:37014217-37014239 CCGTGGAGAGGGAGAGGGAGAGG + Intronic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990297913 5:54421349-54421371 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
990501256 5:56398638-56398660 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
990524545 5:56611991-56612013 TCATGGAGATGGAGAGTGGAAGG + Intergenic
990709588 5:58565156-58565178 AGAGGGAGATGGAGAGTGGGGGG + Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
992086340 5:73281314-73281336 CTGAGGCGATGGAGCGGGGGCGG + Intergenic
992442800 5:76811588-76811610 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
992697089 5:79300425-79300447 CTGTAGGGATAGAGTGTGGGGGG + Intronic
993558813 5:89377417-89377439 CTGTTGAGATGGAGGTTGGTGGG - Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
994575445 5:101573072-101573094 CTGTGGAGATGCTTAGAGGGAGG - Intergenic
994609134 5:102014015-102014037 CTGTGGAAATAGGGAGTGTGGGG - Intergenic
995236410 5:109833686-109833708 CTGTGGGGAGGGGGAGGGGGAGG + Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996843424 5:127873672-127873694 CTTTGGAGATATAGAGTAGGAGG - Intergenic
997250828 5:132387290-132387312 GTGTGGGGGTGGGGAGTGGGGGG - Intronic
997366494 5:133328695-133328717 CTGGTGACAGGGAGAGTGGGAGG - Intronic
997713962 5:136028756-136028778 CTGTGGCGAGGGAGAGAGGGAGG + Intergenic
997771720 5:136561138-136561160 GTCTGGAGATGGAGAATGGAAGG + Intergenic
998045834 5:138985902-138985924 CTGTGGAGCTGGAGATTGCAGGG - Intronic
998432372 5:142077317-142077339 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
998471927 5:142390271-142390293 CTGGGGAGAGGGAGAGTGCAGGG + Intergenic
998478068 5:142438064-142438086 GTGTTGAGATGGAGAGTGACTGG - Intergenic
998658266 5:144206308-144206330 CTCTGGAGAGAGAGAGAGGGAGG - Intronic
999044034 5:148448337-148448359 CTGTCTAGCTGGAGAGTGGTGGG - Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999322252 5:150622779-150622801 CTGTGGAGCAGGGGAGTGGAGGG - Intronic
999441543 5:151604906-151604928 CCTTGGAGATTGGGAGTGGGAGG + Intergenic
1000117305 5:158165838-158165860 GTGTGGGTATGGACAGTGGGTGG + Intergenic
1000129270 5:158279743-158279765 CTGAGGAGATGGAGAGAGATGGG - Intergenic
1001211208 5:169811824-169811846 ATGTGTAGATGCAGAGTGGGGGG - Intronic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001595819 5:172898121-172898143 GTGTTGAGCAGGAGAGTGGGTGG - Intronic
1001603849 5:172946311-172946333 CTGTGGGGATGGGGCCTGGGAGG - Intronic
1001679977 5:173549335-173549357 CTGTGGCCATGAACAGTGGGTGG + Intergenic
1001824355 5:174733478-174733500 CAGTGGAGACGGAGTGGGGGTGG - Intergenic
1001944752 5:175769907-175769929 CTTAGGAGAGGGATAGTGGGGGG + Intergenic
1002295373 5:178227834-178227856 CCATGGAGATGGAGAGGTGGAGG + Intronic
1002364415 5:178698968-178698990 CTGTGGAAATGAAGAGATGGTGG - Intergenic
1002817922 6:696128-696150 CTGTGTAGTAGGAGAGTGAGCGG + Intergenic
1003408947 6:5846548-5846570 CTGTGTACAGAGAGAGTGGGGGG + Intergenic
1003505116 6:6734293-6734315 CTGTCGAGCAGAAGAGTGGGTGG + Intergenic
1003545155 6:7052348-7052370 CTGTGAGGGTGGAGAGGGGGCGG + Intergenic
1004929624 6:20449767-20449789 CAGAGAAGGTGGAGAGTGGGAGG - Intronic
1004978130 6:20991328-20991350 TTCTGGAGATGGACAGTGGGTGG + Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006950747 6:37819720-37819742 CTGCGGAGACGGGGAGGGGGCGG - Exonic
1007013804 6:38442612-38442634 CTGTGAAGAAGGAAAGTTGGAGG + Intronic
1007062166 6:38951018-38951040 CTGTGGAGCTTCAGAGTGTGTGG + Intronic
1007476225 6:42121754-42121776 GTGTGGAGTTGCAGAGTGGGAGG + Intronic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1007590315 6:43017007-43017029 CTGTGGAGGGGTAGTGTGGGAGG + Intronic
1007738915 6:43999326-43999348 CTGTAGAGATGGAGTGTTGCTGG - Intergenic
1007790575 6:44306082-44306104 CTGTGGACATGGGGAGAGGCAGG + Intronic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1009973021 6:70644859-70644881 CTATGGAGATGGAGAAAGAGGGG + Intergenic
1010007453 6:71011068-71011090 CTGTGGGGATGGAGTGGTGGAGG + Intergenic
1010264593 6:73851965-73851987 GTGGGGAGATGGAGAGGGAGAGG + Intergenic
1010331649 6:74630073-74630095 GTGGGGAGAGGCAGAGTGGGGGG - Intergenic
1010918598 6:81652050-81652072 CTTGGGGGATGGAGGGTGGGAGG - Intronic
1011718087 6:90128033-90128055 CTGGGGAAATGGAGATGGGGGGG - Intronic
1012398282 6:98824505-98824527 AAGTGGAGAGGGAGCGTGGGAGG + Intergenic
1012446679 6:99314208-99314230 TTGTGGTGATGGAGAGGGGCGGG - Intronic
1013351331 6:109308659-109308681 ATATGGAGGTGGGGAGTGGGTGG + Intergenic
1013700423 6:112762121-112762143 CAGTGGAGATGGAGTATGAGAGG - Intergenic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1014376477 6:120681087-120681109 CTCTGGCAATGGAGAGTGGTTGG + Intergenic
1014777127 6:125524029-125524051 CTGGGGAGATGGGGAGGGAGAGG - Intergenic
1014787735 6:125637710-125637732 CTGTGGAGATGGATGGTCAGGGG - Intergenic
1015326886 6:131933569-131933591 TTATGGAGATGGAAAGTTGGAGG + Intergenic
1015598076 6:134885144-134885166 GAGGGGAGATGGAGAGAGGGGGG + Intergenic
1016299523 6:142614640-142614662 CTGTGGAGATGGTTGGAGGGGGG + Intergenic
1016365272 6:143309016-143309038 GTGGGGAGTGGGAGAGTGGGGGG + Intronic
1016616939 6:146061058-146061080 CTGTGGAGAGGGAGAGAGATGGG + Intronic
1016915912 6:149244342-149244364 CGGTGGCGGTGGAGGGTGGGTGG + Intronic
1017008431 6:150044956-150044978 TTGTGGGGAGGAAGAGTGGGAGG - Intergenic
1017660495 6:156669646-156669668 CTGTGGAGAGGGAGAGGGAGAGG - Intergenic
1017851706 6:158309901-158309923 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1017981746 6:159406753-159406775 CCGGGGAGAGGGAGAGGGGGAGG - Intergenic
1018399615 6:163409765-163409787 GTGTTGGGATGGGGAGTGGGCGG - Intergenic
1018950859 6:168378020-168378042 CTGTGGAGAAGGAGAAACGGGGG - Intergenic
1018988826 6:168658097-168658119 ATGGGGAGATGGAGAGCAGGTGG + Intronic
1019124088 6:169827702-169827724 CGCTGCAGATGGGGAGTGGGCGG - Intergenic
1019477956 7:1253037-1253059 CTGTGAAGATGAGGAGTGGGGGG - Intergenic
1019491570 7:1316238-1316260 CTGTGGGCAGGCAGAGTGGGTGG + Intergenic
1019656397 7:2198362-2198384 CTGTGGAGAGCGTGAGTGGCTGG - Intronic
1019750135 7:2724086-2724108 TAGTAGAGATGGGGAGTGGGGGG + Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020803060 7:12756038-12756060 CTGTGCTTATGGGGAGTGGGTGG + Intergenic
1021280331 7:18709186-18709208 CTGGGGAGGTAGAGAGTGAGGGG - Intronic
1021301034 7:18973521-18973543 TTGTTGACATGGAAAGTGGGTGG + Intronic
1021368115 7:19806893-19806915 CTTTGGAAATGTAGAATGGGAGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022469784 7:30675098-30675120 CTGGGGCAAGGGAGAGTGGGAGG - Intronic
1022700165 7:32753183-32753205 CTGTGGAGAGAGAGAGGGAGAGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023340886 7:39218333-39218355 GTGTGGGGACAGAGAGTGGGGGG + Intronic
1023569520 7:41557490-41557512 CTGGGGAGATGGGGAGGGGGAGG + Intergenic
1023785267 7:43701252-43701274 ATTTGAGGATGGAGAGTGGGAGG - Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG + Intergenic
1026055460 7:66979868-66979890 CAGAAGAGATGGAGAGTGGATGG - Intergenic
1026410952 7:70122176-70122198 TTTGGGGGATGGAGAGTGGGAGG + Intronic
1026722239 7:72841958-72841980 CAGAAGAGATGGAGAGTGGATGG + Intergenic
1027770407 7:82399677-82399699 CTGGGGGGGTGGGGAGTGGGAGG - Intronic
1028320313 7:89451289-89451311 CTGGGGAGATGAAGGGAGGGAGG - Intergenic
1029173360 7:98646292-98646314 CAGTGGAGATGGAAATGGGGAGG - Intergenic
1029188392 7:98755324-98755346 CTGTGGAGATGCAGAAGGGCAGG + Intergenic
1029193498 7:98788153-98788175 CTGGGGAGGTGGAGATTGTGGGG + Intergenic
1030524265 7:110634791-110634813 TTGCGAAGATGGAAAGTGGGAGG - Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032345831 7:131115674-131115696 CTGCGGTGGTGGAGAGTGGTGGG - Intronic
1032525951 7:132578119-132578141 CAGTGAAGATGGGGAGTGGGTGG + Intronic
1033044429 7:137948436-137948458 TTGTAGAGTTGGAGAGTTGGAGG - Intronic
1033140875 7:138825295-138825317 CTGGGGAGAGGCAGAGTGCGAGG - Intronic
1033492663 7:141859533-141859555 CTGGTGAGATGGGGAGAGGGTGG + Intergenic
1033657793 7:143384766-143384788 ATTTGGAGATGGGGTGTGGGCGG + Intronic
1034213772 7:149387370-149387392 CTGTGGAGGTGGGGCGTGGCAGG - Intergenic
1034445594 7:151112550-151112572 CTCTGGAGACGGAGAGGGGATGG - Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1034882858 7:154775846-154775868 GTGTAGACAAGGAGAGTGGGAGG - Intronic
1035120233 7:156560626-156560648 CGGAGGAGATGGAGACAGGGAGG - Intergenic
1035237692 7:157509271-157509293 ATGGGGAGAAGGAGAGAGGGGGG + Intergenic
1035942409 8:3916799-3916821 CTGTGAAGATGGATTATGGGGGG + Intronic
1036108074 8:5863666-5863688 CTGAGGAGATGGAGAGAGACAGG + Intergenic
1036242306 8:7091197-7091219 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036259543 8:7228959-7228981 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036307080 8:7610565-7610587 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036311587 8:7687529-7687551 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036357926 8:8058552-8058574 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036578369 8:10049988-10050010 CTATGGAGGTGGAGGGAGGGAGG + Intergenic
1036690426 8:10941399-10941421 CTGTGGAGATGGAGAAACTGAGG + Intronic
1036802709 8:11804333-11804355 CTGTTGGGAGGGAAAGTGGGTGG + Intronic
1036830433 8:12015933-12015955 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036891965 8:12602258-12602280 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036893021 8:12608394-12608416 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1037150017 8:15626025-15626047 CTGTGGCGAGGGAGGCTGGGTGG + Intronic
1037157917 8:15728447-15728469 GTGTGGAGAGGGAGGGAGGGAGG + Intronic
1037644758 8:20783251-20783273 CTGTGCAGATGGCGAGGGGATGG + Intergenic
1038241222 8:25809336-25809358 CAGTGGAAATGGAGAATGTGTGG - Intergenic
1038745051 8:30247881-30247903 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1039612055 8:38927933-38927955 TGGTGGGAATGGAGAGTGGGGGG + Intronic
1040460591 8:47644094-47644116 CTGTGAAGATGGAGTGCTGGTGG + Intronic
1040685823 8:49871653-49871675 CTGAGGAGAAGGAGAGATGGGGG + Intergenic
1040954638 8:52967389-52967411 ATGTGAAGGTGGAGGGTGGGAGG - Intergenic
1041122118 8:54597104-54597126 CTGTGGAGATGGAAAATGCCGGG - Intergenic
1041138183 8:54783539-54783561 CTTTGCAGATGGAGACTGGAAGG + Intergenic
1041419282 8:57648359-57648381 CTCTAGAAATGGAGGGTGGGTGG - Intergenic
1042882413 8:73508359-73508381 CTGAGGAGATGGAGAGAGATGGG + Intronic
1042943452 8:74130964-74130986 CTGGGGAGATGGAGAGAGTTGGG + Intergenic
1043013859 8:74913385-74913407 CCGTGGAGGTGGTGAGTGTGTGG - Intergenic
1043416638 8:80057667-80057689 AAGTGGAGAGGGAGAGTTGGGGG + Intronic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044626227 8:94236804-94236826 CTGATGAGATGGGAAGTGGGAGG - Intergenic
1044683821 8:94808028-94808050 TTATGGAGATAGAGAGTGGAAGG - Intergenic
1044876241 8:96669444-96669466 CAGGGGCAATGGAGAGTGGGAGG - Intronic
1046133940 8:110002675-110002697 TCGTGGAGATAGAGAGTGGAAGG - Intergenic
1047213978 8:122862305-122862327 CTGTGGACCTGGTGAGTGGTCGG - Intronic
1047555340 8:125923308-125923330 CAGTGAGGATGGAGACTGGGGGG + Intergenic
1047795112 8:128247305-128247327 CACTGGAAAAGGAGAGTGGGGGG + Intergenic
1047938105 8:129801230-129801252 CTGGGGTGATGGAGAAGGGGTGG + Intergenic
1048288916 8:133164714-133164736 CTGTGGAGAAGGACAGTGAATGG - Intergenic
1049202920 8:141350635-141350657 CTGCTGAGATGGAGTGGGGGTGG - Intergenic
1049251325 8:141590747-141590769 CTGGGGAGGTGGAGAGAGTGTGG - Intergenic
1049299037 8:141860088-141860110 ATGCGGAGATGGAGAGAGGTGGG + Intergenic
1049376639 8:142292474-142292496 CTGTGGAGGTGGTGGGTGGCGGG + Intronic
1049386055 8:142343737-142343759 CAGTGGTGATGGGGAGTGGGGGG + Intronic
1049412321 8:142478767-142478789 CTGTGGAGAAGTGGAGTGTGGGG + Intronic
1049412370 8:142478959-142478981 CTGTGGAGAAGCAGAGTGTGGGG + Intronic
1049517892 8:143071694-143071716 CTGTAGAGAGTGACAGTGGGTGG - Intergenic
1049607560 8:143536748-143536770 CTGGGCAGATGGGGAGGGGGTGG - Intronic
1049790257 8:144469203-144469225 CTGCGGAGGTGGGGGGTGGGAGG - Intronic
1050162831 9:2735767-2735789 CTGTGGACATAGGGAGTGGGTGG - Intronic
1050228106 9:3484912-3484934 CTGTAGAGATGGGGTGGGGGGGG - Intronic
1050692592 9:8244589-8244611 CCTTGGAGATGAATAGTGGGCGG + Intergenic
1050746708 9:8884563-8884585 CTATGGAGCCAGAGAGTGGGAGG + Intronic
1050792584 9:9493010-9493032 CTGAGGAGAGGGAGAGTGATGGG - Intronic
1051506197 9:17830350-17830372 CTGGTGTGTTGGAGAGTGGGTGG - Intergenic
1052360381 9:27549398-27549420 ATGATGAGGTGGAGAGTGGGAGG + Intronic
1052995710 9:34550783-34550805 GTGTGGAGCTGGAGAGGGTGGGG - Intergenic
1053037406 9:34836968-34836990 CTGAGGAGATGGAAAATGGCTGG - Intergenic
1055018678 9:71646046-71646068 TTGTGGAGAAGGAGACTGAGGGG - Intergenic
1055432359 9:76257215-76257237 ATAGGGAGATGGAGAGTTGGGGG - Intronic
1055726752 9:79238348-79238370 TTTTGGAGATCCAGAGTGGGTGG + Intergenic
1056180520 9:84078153-84078175 ATATGGAGATGGAGAGTAGAAGG + Intergenic
1057524508 9:95786665-95786687 CTGTGGAAATGGGGAAGGGGTGG + Intergenic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057716359 9:97498911-97498933 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1057901791 9:98954906-98954928 GAGTGGAGAGGGAGGGTGGGAGG - Intronic
1057905235 9:98977715-98977737 CTAGGGGGATGGAGGGTGGGAGG + Intronic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1058115030 9:101075814-101075836 TGGTGTAGATGGAGAGTGGTTGG + Intronic
1058223825 9:102336411-102336433 CTGTGGAGAAGGGAAATGGGAGG - Intergenic
1058601315 9:106673853-106673875 CCCAGGACATGGAGAGTGGGAGG - Intergenic
1058669703 9:107350537-107350559 GTGGGCAGATGGAGGGTGGGAGG - Intergenic
1058940741 9:109810537-109810559 CTGTTTAGATGGAGAGGTGGAGG + Intronic
1058965114 9:110030189-110030211 GTGTGGAGATAGGAAGTGGGGGG + Intronic
1059208077 9:112485529-112485551 CTCTAGAGATGGAGAGGGGTTGG + Intronic
1059506672 9:114805657-114805679 CAGAGGAAATGTAGAGTGGGAGG - Intronic
1059880119 9:118679057-118679079 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1059880133 9:118679105-118679127 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1060041363 9:120304352-120304374 CCGTGGAGATGGAGAGGGAGAGG - Intergenic
1060180729 9:121531851-121531873 CTGTGTGGAGGAAGAGTGGGTGG + Intergenic
1060317577 9:122526897-122526919 CTGTGGAGTAGCAGAGGGGGTGG + Exonic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061570285 9:131473861-131473883 CTCTGGGGAAGGAGAGTGTGAGG + Intronic
1061588315 9:131582801-131582823 CTGTGGAGTTGGGCAGAGGGTGG - Intronic
1061614806 9:131772796-131772818 CTCTGCAGGTGGAGAGTTGGAGG + Intergenic
1062168513 9:135121437-135121459 GGGTGGAGATGGGGTGTGGGTGG - Intergenic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1062533165 9:137010530-137010552 CAGTGGAGGTGGAGCCTGGGTGG - Intronic
1062600740 9:137317642-137317664 CTGTGGAGAGGTGGTGTGGGTGG + Intronic
1062667533 9:137683867-137683889 CTGCGGGGGTGGAGAGTGAGGGG - Intronic
1062699544 9:137891738-137891760 CTGTGGGGCTGTAGAGTGGAGGG + Intronic
1186293764 X:8126341-8126363 GTGTCTAGGTGGAGAGTGGGAGG - Intergenic
1186480741 X:9894854-9894876 CTGCGGAGAGGGGGAGGGGGAGG - Exonic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186984865 X:15001203-15001225 CTGTGGGGATACAGAGTGTGAGG + Intergenic
1187696791 X:21930431-21930453 GTGAGGAGATCGAGGGTGGGAGG - Intergenic
1187984662 X:24797217-24797239 CAGGGGAAATGGAGAGAGGGTGG - Intronic
1188633726 X:32401525-32401547 CTATGGAGATAGAGAGTAGAAGG + Intronic
1188819070 X:34751383-34751405 ATTTGAAGATGGAGGGTGGGAGG - Intergenic
1189008409 X:37019084-37019106 CTGGGGTGGTGGACAGTGGGAGG + Intergenic
1189040318 X:37535926-37535948 CTGGGGCGGTGGACAGTGGGAGG - Intronic
1189288031 X:39866018-39866040 GTGTCAAGGTGGAGAGTGGGAGG + Intergenic
1189354107 X:40298581-40298603 CTGGGCAGATGGAGAGGGGGAGG - Intergenic
1189809279 X:44765816-44765838 CAGCGGAGTTGGAAAGTGGGTGG - Intergenic
1190109299 X:47579577-47579599 GTTTTGAAATGGAGAGTGGGAGG - Intronic
1190184361 X:48221772-48221794 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1190467139 X:50736390-50736412 CTGGGGAGATGGAGAGCGTTAGG - Intronic
1190505439 X:51120472-51120494 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1190809607 X:53870510-53870532 CCTTGAGGATGGAGAGTGGGAGG - Intergenic
1190839343 X:54130032-54130054 CTGGGGAGAGGGAGAGGGAGAGG + Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191894361 X:65976060-65976082 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1192464261 X:71342553-71342575 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1193869060 X:86774693-86774715 CAGTGGAAATGGTAAGTGGGAGG + Intronic
1194449577 X:94028048-94028070 TTGCGGAGATGGTGATTGGGAGG - Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195252414 X:103062138-103062160 CTGTAGGGGTGGAGAGTGGGAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195719700 X:107854897-107854919 CGGTGATGATGGACAGTGGGGGG + Intronic
1196626605 X:117884412-117884434 CTGTGGAGATAGAGAATAGAAGG + Intergenic
1196852355 X:119949501-119949523 CTGTGGAGGTGGAGTGGGGCAGG - Intergenic
1197862848 X:130988453-130988475 CTGGGGAGTTGGGGTGTGGGAGG + Intergenic
1198036987 X:132810602-132810624 GAGTGGAGATTCAGAGTGGGAGG - Intronic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198542899 X:137659158-137659180 CTGAGGAGATGGATAGAGAGGGG - Intergenic
1199291858 X:146113817-146113839 CTGAGGTGATGGACAGTGTGTGG + Intergenic
1200017835 X:153179699-153179721 CTGAGGAGATGGGGGTTGGGTGG - Intronic
1200039668 X:153355991-153356013 CTGGGGAGTTGGGGAGTGGAGGG - Intronic
1200143773 X:153915191-153915213 CTGTAGAGACGGACAGTGGAAGG + Intronic
1201948159 Y:19535210-19535232 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic