ID: 1121525872

View in Genome Browser
Species Human (GRCh38)
Location 14:94618966-94618988
Sequence CTCATTTAGCACAAGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121525867_1121525872 3 Left 1121525867 14:94618940-94618962 CCTTATTCCCTGGTTCCTATTGA 0: 1
1: 0
2: 1
3: 11
4: 173
Right 1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1121525868_1121525872 -4 Left 1121525868 14:94618947-94618969 CCCTGGTTCCTATTGATTTCTCA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1121525864_1121525872 29 Left 1121525864 14:94618914-94618936 CCTAAACCTTCTTTCTCTCTTGC 0: 1
1: 0
2: 3
3: 69
4: 652
Right 1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1121525869_1121525872 -5 Left 1121525869 14:94618948-94618970 CCTGGTTCCTATTGATTTCTCAT 0: 1
1: 0
2: 1
3: 26
4: 207
Right 1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1121525863_1121525872 30 Left 1121525863 14:94618913-94618935 CCCTAAACCTTCTTTCTCTCTTG 0: 1
1: 0
2: 2
3: 46
4: 593
Right 1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1121525865_1121525872 23 Left 1121525865 14:94618920-94618942 CCTTCTTTCTCTCTTGCACTCCT 0: 1
1: 0
2: 8
3: 241
4: 2206
Right 1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121525872 Original CRISPR CTCATTTAGCACAAGGAACT AGG Intronic
902187756 1:14738146-14738168 GTCATTTATCACATGGAGCTGGG - Intronic
904953081 1:34260107-34260129 CTAATTTGGCAAAAGGAATTTGG - Intergenic
906111362 1:43324315-43324337 CTCATTTAACACAAACAACGAGG - Intergenic
906745912 1:48222098-48222120 ATCATTTATTCCAAGGAACTAGG - Intergenic
909118824 1:71574708-71574730 CTATTTTAGCCCAAGGGACTTGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911533807 1:99077392-99077414 CTCATTCATCCCAAGGAAGTAGG + Intergenic
914445925 1:147750716-147750738 CTCATGCAGCACCAGGACCTGGG - Intergenic
918004218 1:180526646-180526668 CTCATTTAATGCCAGGAACTAGG + Intergenic
920593011 1:207240521-207240543 CTCATTTACCAAAAGTAACTCGG - Intergenic
921080990 1:211738292-211738314 ATAATTTAGTACAAGGAATTAGG - Intergenic
921398020 1:214689381-214689403 CTGACTTAGCAAAAGGAACTGGG + Intergenic
922841890 1:228648987-228649009 CGCCTTTAGTACAAGGTACTCGG - Intergenic
923607558 1:235458276-235458298 CTCAGTTTTCGCAAGGAACTGGG + Intronic
924028265 1:239861022-239861044 GTCACTTAGCAGGAGGAACTAGG + Intronic
924129538 1:240891674-240891696 TCCATTTAACACAAGGAATTAGG - Intronic
1065136521 10:22676201-22676223 CTTATTGAGCAGAAGAAACTTGG - Intronic
1065727701 10:28681974-28681996 CTCCTTTAGGACAAGGAAACAGG + Exonic
1070424011 10:76267769-76267791 CTCATTTGACACAACCAACTTGG + Intronic
1071802331 10:89077369-89077391 TTCATTTAGCACAATGAAAAAGG + Intergenic
1072027945 10:91482436-91482458 CTCATATATCACAAAGAACAAGG - Intronic
1072478382 10:95785614-95785636 CTCATTTGGCTGAAGGAAGTTGG + Intronic
1073727373 10:106248924-106248946 CTCATTTTACAGAAGGAACTTGG - Intergenic
1073895875 10:108156879-108156901 CTCATTTTCCACAAAGTACTAGG - Intergenic
1075286718 10:121193458-121193480 GTCATTAAGGGCAAGGAACTTGG + Intergenic
1078326881 11:10388395-10388417 CACCTTTACCCCAAGGAACTTGG - Intronic
1078826272 11:14933534-14933556 GTCTTTTAGCACAAGGTGCTTGG + Intronic
1080024157 11:27596269-27596291 CTCATGTGGCAGAAGGAACAAGG - Intergenic
1085364114 11:75922590-75922612 TTCAATTAGAACAAGGAACTGGG - Intronic
1086145540 11:83547331-83547353 CTTATATAGCAAAAGGGACTTGG + Intronic
1087194941 11:95295976-95295998 CTCACTATGCACCAGGAACTGGG - Intergenic
1088605275 11:111524124-111524146 GACATCTAGCTCAAGGAACTGGG - Intronic
1090447335 11:126775537-126775559 CTCATTTAGAAAGATGAACTGGG - Intronic
1090746384 11:129708897-129708919 CTCATTTAGCAACAAAAACTTGG + Intergenic
1092101003 12:5883677-5883699 CTCCTCTACCACCAGGAACTGGG + Intronic
1094669198 12:32552622-32552644 CTCCATTAGTACATGGAACTCGG + Intronic
1095227307 12:39693392-39693414 CTCATGTTGCAGAAGGAAATAGG - Intronic
1096042698 12:48531965-48531987 CTCATCTATCACAAGGTTCTTGG - Intergenic
1098874868 12:75856530-75856552 ATCATTTAGCACAAAGCAATTGG - Intergenic
1099622430 12:85020923-85020945 CTCATTCATCACAAGGCTCTTGG - Intronic
1103976071 12:124703567-124703589 CTCACCTAGCAAAAGGGACTTGG + Intergenic
1106556787 13:30816745-30816767 CTTATTTAACACATGGCACTAGG + Intergenic
1107183942 13:37495386-37495408 CTCATTTAGCAGAAGAAGCATGG + Intergenic
1109120523 13:58450146-58450168 CTCACTTGGCACAAGGGACAAGG - Intergenic
1112078699 13:95941864-95941886 CTCCTGAAGCACAAGGAAATGGG - Intronic
1112104111 13:96221703-96221725 CTCATATATCAGAAGGAACAAGG + Intronic
1113970005 13:114181436-114181458 CTCATTTAGGACAAAGAAATGGG + Intergenic
1116245292 14:42404012-42404034 CTCATTTACCAAGAGGATCTAGG + Intergenic
1116386215 14:44333778-44333800 CTAATTTAGCACAAGGATTCTGG + Intergenic
1119031751 14:71198113-71198135 CTCTTTTTGCACAAGGAGCATGG - Intergenic
1119816112 14:77569478-77569500 CTCATTTTACAAAAGAAACTTGG + Intronic
1121043245 14:90767667-90767689 GTCATATAACACAAGAAACTGGG - Intronic
1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG + Intronic
1122978391 14:105180503-105180525 CTCACTTAGCACCAGGCACATGG - Intronic
1123971328 15:25510650-25510672 CTCATTGAAAACAAGGAACCAGG + Intergenic
1124089312 15:26582963-26582985 CTCATTTCCCATCAGGAACTCGG - Intronic
1125009891 15:34859941-34859963 CTGATTTCCCACAAGGAATTAGG + Intronic
1126806267 15:52352355-52352377 CTCATTTAGCACAGGACACAAGG + Intronic
1127717977 15:61669158-61669180 CTCATTTATGAGAAGGACCTAGG - Intergenic
1134448165 16:14346308-14346330 CATATGTAGCACAAGGGACTTGG + Intergenic
1135614111 16:23895433-23895455 GACATTTAGCTCAAGAAACTAGG - Intronic
1136667183 16:31822121-31822143 CTCATTGAGCTCAATGAACATGG - Intergenic
1137291383 16:47054374-47054396 CTCTCTTGGCACAAGGAACATGG + Intergenic
1137924667 16:52528856-52528878 CTCATGTGGCACCAGGCACTAGG + Intronic
1138193493 16:55035421-55035443 CTCCTTCTGCACAAGTAACTTGG - Intergenic
1138415997 16:56871658-56871680 CTCATTTAGCAGGATGACCTGGG - Intronic
1141232820 16:82186257-82186279 CTCAGTGAGCACAAGGAATGAGG + Intergenic
1143407631 17:6688086-6688108 GTCATTTTGCACATGGAATTTGG + Intronic
1143834430 17:9678949-9678971 CCCATGTAACACAAGGATCTTGG + Intronic
1144119740 17:12140289-12140311 CTCATTCATCCCATGGAACTTGG + Intronic
1145973254 17:28969386-28969408 CTCCTTGAGGACAAGGACCTTGG + Intronic
1150978494 17:70115769-70115791 CTCATTTAAAACAAGGAGGTGGG - Intronic
1151344994 17:73496041-73496063 CTCATTGAGGAAAAGGAACCTGG + Intronic
1155277879 18:24206768-24206790 CTAATTTAGAACAATGAAATTGG + Intronic
1158388026 18:57016744-57016766 CTCATTAAAGAAAAGGAACTGGG - Intronic
1162656713 19:12136842-12136864 CTCACTTACCAGAAGGAACAGGG + Intronic
1166953821 19:46448314-46448336 TTCATGTAGCAAAAGGGACTTGG + Intergenic
929313673 2:40452631-40452653 TTCTTTTAGCAAAAGGATCTGGG + Intronic
939533237 2:143391314-143391336 CTGATTTATCCCAAGAAACTAGG - Intronic
939670659 2:145007613-145007635 GCCAGCTAGCACAAGGAACTCGG - Intergenic
944482593 2:200173165-200173187 TTCATTTAGGACGAGTAACTGGG - Intergenic
945088465 2:206157382-206157404 CTCCTTGAGGACAAGGAATTTGG + Intronic
945424618 2:209684901-209684923 CTCATTTAGCACATCAAAGTTGG - Intronic
945755240 2:213837698-213837720 CTTATATAGCAAAAGGCACTTGG + Intronic
945784717 2:214218548-214218570 CTCATTTGGCAGAAGAACCTGGG + Intronic
946604709 2:221390702-221390724 CTTAATTAGGAAAAGGAACTAGG + Intergenic
947274589 2:228375833-228375855 CTAATTGAGCACAAGGATATGGG + Intergenic
947529288 2:230898671-230898693 CTAACTTTCCACAAGGAACTGGG - Intergenic
1168853100 20:989953-989975 ATGATTTAGTACAAGGACCTGGG - Intronic
1169028715 20:2391545-2391567 TTCATCTTGGACAAGGAACTAGG - Intronic
1169974239 20:11305598-11305620 TGCAGTTAGCACAATGAACTTGG - Intergenic
1170781085 20:19426020-19426042 CACAGTTAGCACATGGACCTGGG - Intronic
1171469442 20:25358306-25358328 CCCATTTAGCACAAGGATGCTGG + Intronic
1175651313 20:60726486-60726508 CTGAATTATGACAAGGAACTAGG + Intergenic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
1183592472 22:38787979-38788001 CTCCTTTGGCACAAGCAAGTAGG + Intronic
1184085371 22:42259481-42259503 GCCATTTAGGAGAAGGAACTGGG - Intronic
949100809 3:142798-142820 CACATTTAGCACACAGATCTTGG - Intergenic
949778859 3:7663300-7663322 CCCACTCGGCACAAGGAACTGGG + Intronic
950785261 3:15428530-15428552 CTCTTTACCCACAAGGAACTTGG - Intronic
954433391 3:50483290-50483312 CCCAGTTAGCACAGGGACCTTGG + Intronic
956289127 3:67643271-67643293 CTCACTTATCACCAGAAACTGGG + Intronic
959515612 3:107263546-107263568 TTCATTTACCAAAAGGAACACGG - Intergenic
963944030 3:151125750-151125772 CTCATGGAGCACAAGGCTCTCGG - Intronic
970374037 4:15438514-15438536 CTCATTTAGGATAGGGAAGTTGG - Intronic
970947155 4:21708040-21708062 GTCATTTAGAATAAGGAACTGGG + Intronic
971536604 4:27759749-27759771 CTCATGTAGCATAAGGAGGTAGG - Intergenic
971536784 4:27762350-27762372 CTCATATGGCACAAGGAGCAAGG + Intergenic
972855520 4:43101361-43101383 CTAAGTTATCACAAAGAACTTGG + Intergenic
975423482 4:74197357-74197379 CTCATATAACAAAAGGAAGTAGG + Intronic
978740862 4:112136378-112136400 CTCATTTGGCAGAAGGAAGAAGG + Intergenic
979692314 4:123573074-123573096 CTCATTTTACATAAGGGACTTGG + Intergenic
980453537 4:133008453-133008475 CTCAACTAGAACAAGGAACATGG + Intergenic
982839199 4:160160651-160160673 CTCATTTAGCAAAATGCAGTTGG - Intergenic
984119594 4:175725591-175725613 CTCATTTGGCATAAGAAAATGGG - Intronic
986295132 5:6431339-6431361 CTCATCCAGCACAAGGTGCTGGG - Intergenic
986374667 5:7117819-7117841 CTCAGATAGCAGAAGGAACAAGG - Intergenic
989413738 5:41149723-41149745 CTCATTTTAAACAGGGAACTGGG + Intronic
997665702 5:135628066-135628088 CTCCTTTGACACAAGGAATTTGG + Intergenic
997697172 5:135870800-135870822 CTCTTTTAACATAAGGAAATGGG + Intronic
998314391 5:141168377-141168399 CTTATTTGGCATGAGGAACTAGG - Intergenic
1004944860 6:20600977-20600999 CTCATTCAGCACTCAGAACTTGG - Intronic
1008565737 6:52766283-52766305 CACCTTTAGCACAGGGAAGTTGG + Intergenic
1009345820 6:62612022-62612044 CTCATTTACCTAAAGGACCTGGG - Intergenic
1009786563 6:68347958-68347980 CTCATTTAGTACCTGGATCTTGG - Intergenic
1010930905 6:81801780-81801802 CTCATATAGCGAAAGGAACAAGG - Intergenic
1011630372 6:89317300-89317322 CTCTTCTTGCACAAAGAACTGGG - Intergenic
1011728606 6:90236390-90236412 CACAATTAGCACAAAGCACTTGG + Intronic
1011763130 6:90589721-90589743 CTCATTTAGAACAAGCAAAGAGG - Intergenic
1013596804 6:111667962-111667984 CTCAGTTAGCAAAAGGAATTTGG - Intronic
1013715364 6:112954620-112954642 TTCATATAGCAGAAGGAACAGGG - Intergenic
1013877518 6:114851121-114851143 TTCATTTAGCTCAAAGATCTTGG + Intergenic
1017336153 6:153262724-153262746 CGCATTTAGCACAAGGCTGTTGG - Intergenic
1019972269 7:4550426-4550448 CCCATTGAGCAGAAAGAACTTGG - Intergenic
1023079586 7:36514605-36514627 CTCATTTAGCAAATGGGACCTGG + Intronic
1024439002 7:49393434-49393456 CTCATATAGCAAAAGCAACTTGG + Intergenic
1026080528 7:67215117-67215139 CCCACCTAGGACAAGGAACTAGG + Intronic
1026696560 7:72598912-72598934 CCCACCTAGGACAAGGAACTAGG - Intronic
1026702756 7:72661609-72661631 TTCATTTAGCAAAAGGACCAAGG - Intronic
1028156846 7:87439724-87439746 CTCATCCAGCAGAAGGATCTTGG + Exonic
1030831466 7:114227498-114227520 GTAATTCAGCACAAGGACCTGGG + Intronic
1032572690 7:133017074-133017096 CCCAGTTAGCACAAGGGCCTGGG + Intronic
1032670570 7:134078748-134078770 CTAATAAAGCACAAGGTACTAGG + Intergenic
1032904209 7:136345786-136345808 CTCATTTTGATCAAGTAACTTGG - Intergenic
1036192107 8:6679649-6679671 CGCATTAACCAGAAGGAACTTGG - Intergenic
1037862994 8:22419547-22419569 CTCATTCATCTCAGGGAACTGGG - Exonic
1038118934 8:24590161-24590183 TTAATTAAGTACAAGGAACTAGG + Intergenic
1039876277 8:41589325-41589347 GGCATTCAGCAAAAGGAACTCGG + Intronic
1041589386 8:59559412-59559434 CTCACTTATCACAAGGATCATGG + Intergenic
1042210248 8:66372815-66372837 CTTATTGTGCTCAAGGAACTGGG + Intergenic
1043975026 8:86575036-86575058 CTCATCTGGCTCAAGGGACTTGG - Exonic
1046290088 8:112147776-112147798 CTCATTTGCCACAGGGAATTGGG + Intergenic
1047978113 8:130151682-130151704 GTCATTTACCACAAAGGACTGGG + Intronic
1048044594 8:130761408-130761430 GAGGTTTAGCACAAGGAACTAGG - Intergenic
1048367477 8:133750906-133750928 CTCATGTGGCAGAAGGAACGAGG - Intergenic
1050523812 9:6528277-6528299 CTCATTTAGAAAAAGGATTTAGG + Intergenic
1050632931 9:7579795-7579817 CACATTGAGCACAGGGATCTTGG + Intergenic
1051573422 9:18585746-18585768 CTAATTTAGCATGAGCAACTAGG + Intronic
1052207524 9:25861007-25861029 CTCTTATAGCACAAGGAAATGGG + Intergenic
1057587705 9:96344639-96344661 CTCATCCAGCACAAAGAGCTTGG + Intronic
1058103236 9:100939521-100939543 CTTATGTAGCAGAATGAACTGGG - Intergenic
1058467408 9:105243776-105243798 CTGATTTAGCAACAGGAACTTGG + Intergenic
1058946498 9:109862027-109862049 CTCCTTGAGGACAAGGATCTTGG - Intronic
1061387955 9:130301520-130301542 CCCATTTAGCTCATGGAAATGGG + Intronic
1188769456 X:34133908-34133930 CTCATTTACAAGGAGGAACTAGG - Intergenic
1189041643 X:37547250-37547272 CTCATTTACAAGGAGGAACTAGG - Intronic
1189895454 X:45651059-45651081 CTCATTTAATACAATGAAATAGG + Intergenic
1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG + Intergenic
1191621413 X:63219392-63219414 CACATCTAGCACAAAGATCTTGG - Intergenic
1194767636 X:97860561-97860583 CTGATTTAACACCAGGGACTGGG - Intergenic
1195222096 X:102754985-102755007 CTCATTTAGCAAACAAAACTAGG + Intergenic
1196241633 X:113348949-113348971 CCCATTTAGGAAAAGGAACTTGG + Intergenic
1198504401 X:137287186-137287208 TTCATTTTACAGAAGGAACTGGG - Intergenic