ID: 1121525934

View in Genome Browser
Species Human (GRCh38)
Location 14:94619330-94619352
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 2, 1: 0, 2: 3, 3: 17, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121525934_1121525939 29 Left 1121525934 14:94619330-94619352 CCTGCACCGTGGTGGAGCTGAAG 0: 2
1: 0
2: 3
3: 17
4: 138
Right 1121525939 14:94619382-94619404 CCTCCCTGATCAAGACAAGATGG 0: 2
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121525934 Original CRISPR CTTCAGCTCCACCACGGTGC AGG (reversed) Exonic
903867821 1:26411457-26411479 CCTCAGCTGCTGCACGGTGCGGG + Exonic
906059195 1:42937260-42937282 CTGCACCTCCACCACCGTGCTGG - Intronic
906152785 1:43597785-43597807 CATGGGCTCCACCACGGTCCGGG + Exonic
907022981 1:51086878-51086900 CTTCAGCTCCAACACCGGGGGGG + Intergenic
909148631 1:71970888-71970910 ATTCAGCTCCACCATTGTACTGG + Intronic
917575215 1:176314233-176314255 CTTCAGCTCGCGCATGGTGCGGG + Intergenic
919896553 1:202012885-202012907 CCTCTGCTCAACCACGCTGCTGG - Intronic
922699112 1:227747928-227747950 CTTCAGCTCCATCACCATCCTGG + Exonic
923675828 1:236080178-236080200 CTTCAGCCTCACCAAAGTGCTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067225531 10:44373667-44373689 CCTCAGCCCCACGCCGGTGCCGG - Intronic
1068284897 10:54921905-54921927 CTTCTGCTCCACCATGGAGCAGG - Intronic
1068805530 10:61190655-61190677 CCTCAGCTCCCCCAAAGTGCTGG + Intergenic
1069854829 10:71434329-71434351 TCTCAGCTCCCCCAGGGTGCGGG + Intronic
1073053086 10:100681705-100681727 CATCAGCTCCTCTAGGGTGCAGG + Intergenic
1074766687 10:116705170-116705192 CTACAGCTTCACCAAGGAGCCGG - Exonic
1075651099 10:124128737-124128759 GTCCACCTCCACCGCGGTGCTGG - Intergenic
1077546092 11:3170691-3170713 CTCCAGCACCACCATGGGGCAGG - Intergenic
1084320782 11:68372373-68372395 CCTCAACACCACCACGGTCCCGG - Intronic
1084891074 11:72237475-72237497 CCTCAGCCCCACCACGGCCCCGG - Exonic
1084951707 11:72670016-72670038 CTCCTGCTCCACCACGGCCCAGG + Intronic
1088400334 11:109416502-109416524 CCTCAGCCCCACCACGTTGCTGG - Intergenic
1088785662 11:113179467-113179489 CCTCAGCTCACCCACTGTGCAGG + Intronic
1088933093 11:114371985-114372007 CTTCTGCTCCACCACAGGCCAGG - Intergenic
1090007726 11:123017631-123017653 CTCCTTCTCCACCATGGTGCCGG - Intergenic
1090264014 11:125342820-125342842 CTCCAGCTCCTCCACGGTGGTGG - Intronic
1090784087 11:130033137-130033159 CTTCAGCTCGAACACCGTGCTGG + Intergenic
1091135270 11:133182784-133182806 CTTCAGCACCACCGCGTTCCTGG - Intronic
1092515071 12:9202771-9202793 CTTCAGCTTCACCAAGGAGAAGG + Intronic
1093218296 12:16388439-16388461 CTTCAGCTCCGTGACGATGCTGG - Intronic
1094302563 12:28981856-28981878 CTTCAGCTCCCCCAAGTAGCTGG - Intergenic
1095954413 12:47798188-47798210 CTTCTGCTTGACCACGCTGCTGG + Exonic
1102589828 12:113948852-113948874 CTCCAGATCCTCCTCGGTGCTGG + Exonic
1104424032 12:128659954-128659976 TCTCAGCTCCACCGCGCTGCTGG + Intronic
1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG + Intronic
1105963667 13:25366072-25366094 CTTCAGCTCGAACACCGCGCTGG + Intergenic
1112410920 13:99163054-99163076 CATCAGCTCCAAAACGGGGCAGG - Intergenic
1116653836 14:47626917-47626939 CTCCACCTGCACCCCGGTGCGGG + Intronic
1117135442 14:52730467-52730489 CTTCACGTCCTCCATGGTGCTGG - Exonic
1118756601 14:68849464-68849486 CTGCAGCTCAACCATGGTGGAGG + Intergenic
1119400043 14:74357100-74357122 CAGCATCTCTACCACGGTGCGGG - Exonic
1121525934 14:94619330-94619352 CTTCAGCTCCACCACGGTGCAGG - Exonic
1121526062 14:94620376-94620398 CTTCAGCTCCACCACGGTGCAGG + Intronic
1121791715 14:96704218-96704240 CATCAGTTCCCCCAAGGTGCTGG - Intergenic
1122275621 14:100589338-100589360 CTTCAGCTCCAGCAGCTTGCAGG + Intergenic
1122635313 14:103126996-103127018 CTTCAGCTCCTCCACTGCGCCGG - Exonic
1122901961 14:104785735-104785757 CTTCCGCTCCACCATGGAGCAGG + Intronic
1124112421 15:26804405-26804427 CCTCAGCTCAACCAGGCTGCCGG + Intronic
1125429672 15:39581845-39581867 CAACAGCTCCACCATGGGGCTGG + Exonic
1126530694 15:49707622-49707644 CTTCTGCTCCACCAGGGTGAAGG + Intergenic
1127752568 15:62060365-62060387 CCTCAGCGCCACCATGGTGCTGG - Exonic
1132987777 16:2777047-2777069 CTTCAGTTCGAACACCGTGCTGG + Exonic
1133130673 16:3674539-3674561 CGTCTTCTCCACCACCGTGCAGG + Intronic
1133283803 16:4681358-4681380 CATCAGCTCCAGCACGGGGCTGG - Intronic
1134225377 16:12385913-12385935 CCTCACCCCCACCACTGTGCAGG - Intronic
1136230889 16:28884612-28884634 CATCAAATCCACCACGCTGCGGG + Exonic
1138133209 16:54499816-54499838 ATGGAGCTCCAGCACGGTGCAGG - Intergenic
1139447501 16:67006852-67006874 CTTCAGGTCCAGCACTGGGCAGG - Intronic
1140216398 16:73012255-73012277 CTGCAGCTCAACCTCTGTGCTGG + Intronic
1141072030 16:80965785-80965807 CTTCAGCCCCACCAAGTAGCTGG - Intergenic
1142856924 17:2736016-2736038 CTTCAACTTCACCACAGTCCAGG + Intergenic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1146446539 17:32936916-32936938 CTTCAGCTCCCACCCAGTGCTGG - Intronic
1146681997 17:34815183-34815205 TCTCAGCTCCTCCAGGGTGCAGG - Intergenic
1147189724 17:38731345-38731367 CTTCAGGGCCACCACGGACCTGG - Exonic
1148642428 17:49198294-49198316 CCTCAGCTCCCCCAAAGTGCTGG - Intergenic
1149670971 17:58409768-58409790 CTTCAGCTCCCCCAAGTAGCTGG - Intronic
1152677224 17:81647910-81647932 CTGCAGCTCCCCCGGGGTGCAGG + Exonic
1152686218 17:81695051-81695073 CCTCACCTCCACCACGTTGGTGG - Exonic
1152892875 17:82892343-82892365 CAACAGCTCCACCTGGGTGCAGG + Intronic
1153637656 18:7127144-7127166 CTCCAACTCCACCATGGTGCAGG + Intergenic
1158650994 18:59285645-59285667 CTGCTTCTCCACCACCGTGCAGG + Intronic
1159879247 18:73842971-73842993 CTTCAGCTGCACCACCTAGCGGG + Intergenic
1162336184 19:10061966-10061988 CTTCAGGTCCACCCAGGTGATGG + Intergenic
1162955668 19:14096626-14096648 CCTCAGCTCAACCACCTTGCTGG - Intronic
1165385204 19:35506266-35506288 CTTCATCCCCACCTCGGTCCAGG + Intronic
1167359087 19:49020374-49020396 CTTCACCCCGCCCACGGTGCAGG - Intergenic
1168560146 19:57375399-57375421 CCTCAGCCCCCCCAAGGTGCTGG - Intronic
926035049 2:9630158-9630180 ATCCATCTGCACCACGGTGCTGG - Exonic
926819872 2:16840245-16840267 CTTCAGCCCCACCAAGTAGCTGG - Intergenic
927435043 2:23059512-23059534 CTTCAGCTGCCCCACAGTGAAGG - Intergenic
927597251 2:24407541-24407563 CTTCAGCCCCCCCAAAGTGCTGG + Intergenic
930493870 2:52112202-52112224 GTTAAGCTCCACCACTGTGGTGG + Intergenic
930817388 2:55612466-55612488 CTTCAGCACCTCCATGGTGCTGG - Intronic
932420516 2:71598708-71598730 GTACAGCTCCACCACAATGCTGG - Exonic
934751411 2:96796393-96796415 CTTCAGCCCGTCCAAGGTGCTGG + Intronic
936832645 2:116667283-116667305 CCTCAGCTCCCCCAAAGTGCTGG + Intergenic
937412591 2:121689496-121689518 TTCCAGCTCCACCAGGGGGCAGG - Intergenic
937858053 2:126686917-126686939 CCTCAGCTCCAGCAAGGGGCAGG + Intronic
937998343 2:127712144-127712166 CTTCAGCCCCCCCAGAGTGCAGG - Intronic
940705091 2:157094846-157094868 CTTTTGCTCTACCAGGGTGCTGG + Intergenic
944302069 2:198134818-198134840 CTTCACCACCTCCACAGTGCTGG - Intronic
945848106 2:214972520-214972542 CTTCAGCCCCACCAAGTAGCTGG + Intronic
948484725 2:238273103-238273125 CTCCATCTCCTCCACGGTGTAGG + Exonic
948709941 2:239819255-239819277 CTTCAGCTCCAGTAAGGTGCTGG + Intergenic
948727462 2:239943886-239943908 CTTTAGCTCCATCACTGTCCAGG - Intronic
1168735272 20:130118-130140 CTTCGGCTCGCGCACGGTGCCGG - Intergenic
1170802621 20:19602935-19602957 GCTCAGCTGAACCACGGTGCGGG - Intronic
1175061119 20:56244227-56244249 CTTCAGCTCCCCCATCCTGCAGG - Intergenic
1175272178 20:57742135-57742157 CTTCATCCCTACCACGATGCTGG + Intergenic
1175984342 20:62756478-62756500 CTTGAGCTCCTCCCTGGTGCTGG + Intronic
1176306444 21:5125958-5125980 CTTCAGCCCCTCCACGGCTCAGG + Exonic
1179850615 21:44136072-44136094 CTTCAGCCCCTCCACGGCTCAGG - Exonic
1181173055 22:21021013-21021035 CTTCAGCTCCACCCAGTGGCAGG - Intronic
1183454780 22:37916676-37916698 CTGCAGCTCCTCCAGGGTGGGGG - Intronic
950510728 3:13424819-13424841 CTTCAGCACCACCTCTGAGCTGG + Intergenic
951564094 3:23995492-23995514 CTGCACGTCCATCACGGTGCTGG - Intergenic
952404909 3:32997213-32997235 CTCCAGTTCCAGCACGGTGATGG + Exonic
953206863 3:40838627-40838649 TTCCATCTCCACCAGGGTGCAGG - Intergenic
959395527 3:105832794-105832816 CTTCATTTCCAACACGGTGTAGG - Intronic
960629672 3:119717176-119717198 CTTCAGTTGCACCAGTGTGCAGG - Intronic
965711523 3:171560361-171560383 GTTCAGGTCCACCAGGTTGCTGG + Intergenic
965955004 3:174359329-174359351 CTTCAGTTCAACCTTGGTGCTGG + Intergenic
967290329 3:187913632-187913654 CTTCACCCCCGCCACAGTGCAGG + Intergenic
969610377 4:8224772-8224794 CATCAGCTCCATCAGGGAGCAGG - Intronic
971116133 4:23647597-23647619 CTTCGGCTCACGCACGGTGCAGG + Intergenic
971471658 4:27033042-27033064 ATTCAGCTTTACCACGCTGCTGG - Intergenic
976608551 4:87006234-87006256 CTTCAGCTCCTCCGGTGTGCTGG + Intronic
987520059 5:18970267-18970289 ATTTAGCTCCACCTCCGTGCAGG + Intergenic
993665837 5:90694561-90694583 CATCAGCTCCACCAAGGTTTGGG - Exonic
994353679 5:98773183-98773205 CTTCAGCTCCACCTCCTTGGAGG - Intronic
997900313 5:137757362-137757384 CCTCAGCCCCCCCACAGTGCAGG - Intergenic
998227266 5:140336599-140336621 CTCCAGCTCCCCCTGGGTGCAGG + Intronic
999047197 5:148482182-148482204 CTGCAGCTCCCCCAAGGTGCAGG - Exonic
999314247 5:150574049-150574071 TTTCAGCTCCTCCGCGGCGCTGG - Intergenic
1000273190 5:159706441-159706463 GTTCAGCTCCTCCACCTTGCAGG - Intergenic
1001676263 5:173519181-173519203 CTTCAGCTCCAGCTCCATGCTGG + Intergenic
1003396153 6:5753833-5753855 TCTCAGCACCACCATGGTGCTGG - Intronic
1010245060 6:73654600-73654622 CTTCAGCTCCCCCAAGTAGCTGG + Intergenic
1011945619 6:92898462-92898484 CCTCAGCCCCACCAAGGTGCTGG + Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1015843107 6:137493736-137493758 CTTCATCTCCTCCAGGGAGCTGG + Exonic
1016840478 6:148519844-148519866 CTTCATCTCCCCCTCGGTGAGGG - Exonic
1018915680 6:168131066-168131088 CCTCAGCAGCAGCACGGTGCTGG + Intergenic
1019810501 7:3161922-3161944 CCTCAGCTTCACCAAAGTGCTGG - Intronic
1021106374 7:16644637-16644659 CTTCTGCACCCTCACGGTGCAGG - Intronic
1023717543 7:43059247-43059269 CTTCGGCTCGCGCACGGTGCGGG - Intergenic
1025969253 7:66306963-66306985 CTTCAGCCTCCCCACAGTGCTGG + Intronic
1026789787 7:73324217-73324239 CTGCAGCTCAACCCAGGTGCCGG - Intronic
1029126975 7:98301241-98301263 CGTCACCTCCACCCCTGTGCTGG + Intronic
1032059779 7:128714962-128714984 CTGCAGATCCACCAGGGTGTCGG + Intronic
1034353403 7:150432055-150432077 CCTCAGCACCACCATGGAGCAGG - Intergenic
1035075260 7:156173598-156173620 ATTCAGAGCCACCACCGTGCTGG - Intergenic
1038405849 8:27322103-27322125 CCTCAGCCCCACCAAGGAGCTGG + Intronic
1042942166 8:74118606-74118628 CTTCAGCCCCCCCAAAGTGCTGG + Intergenic
1043119735 8:76308260-76308282 CTTCAGCTCGCGCACGGTGCGGG - Intergenic
1044954273 8:97463203-97463225 CTTCAGATCCACCACTGTGCTGG - Intergenic
1048271180 8:133029450-133029472 CTTCAGGTCCACCACTGTCTTGG - Intronic
1049992126 9:1000218-1000240 CTGCAGCTCCACCGGGGAGCAGG + Intergenic
1052939225 9:34118847-34118869 CTTCAGCACCACCAAGTAGCTGG - Intronic
1055286883 9:74738471-74738493 CATCAGCTCCTCCAGGGTGTTGG + Exonic
1058412317 9:104747643-104747665 GGTCAGCTCCACCCCGGCGCGGG - Intergenic
1058413776 9:104764091-104764113 GGTCAGCTCCACCCCGGCGCGGG - Intergenic
1059628858 9:116097570-116097592 ATTCAGCTCCACCACCATTCTGG - Intergenic
1186509285 X:10118309-10118331 GTTCAGCTCCTCCTCGGAGCTGG + Intronic
1188461776 X:30435457-30435479 CTACAGCTCCACCACTGAGAAGG + Intergenic
1189312082 X:40026251-40026273 CTCCAGCTCCACCACCCAGCAGG - Intergenic
1192506249 X:71685380-71685402 CTTCAGCTCCACCCCAGTGCCGG - Intergenic
1192520448 X:71796168-71796190 CTTCAGCTCCACCCCAGTGCCGG + Intergenic
1197183387 X:123561626-123561648 CCTCAGCACCACCACCATGCAGG + Intergenic