ID: 1121526586

View in Genome Browser
Species Human (GRCh38)
Location 14:94623604-94623626
Sequence CAGCCTTATGGACCACCTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 11, 3: 13, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121526586_1121526590 -2 Left 1121526586 14:94623604-94623626 CCCACAGGTGGTCCATAAGGCTG 0: 1
1: 0
2: 11
3: 13
4: 94
Right 1121526590 14:94623625-94623647 TGTGCTTGATGTATTTGAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 212
1121526586_1121526589 -5 Left 1121526586 14:94623604-94623626 CCCACAGGTGGTCCATAAGGCTG 0: 1
1: 0
2: 11
3: 13
4: 94
Right 1121526589 14:94623622-94623644 GGCTGTGCTTGATGTATTTGAGG 0: 1
1: 0
2: 3
3: 19
4: 216
1121526586_1121526591 -1 Left 1121526586 14:94623604-94623626 CCCACAGGTGGTCCATAAGGCTG 0: 1
1: 0
2: 11
3: 13
4: 94
Right 1121526591 14:94623626-94623648 GTGCTTGATGTATTTGAGGAGGG 0: 1
1: 0
2: 3
3: 29
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121526586 Original CRISPR CAGCCTTATGGACCACCTGT GGG (reversed) Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905112323 1:35604821-35604843 CAGCCTCAGTTACCACCTGTAGG + Intronic
906196133 1:43931870-43931892 CAGCCTTAGGGCTCACCAGTGGG - Intergenic
906372347 1:45265006-45265028 CAGGCTTGTGGACCTCCTTTTGG + Intronic
908153016 1:61324082-61324104 CTGGCTTATGAGCCACCTGTGGG - Intronic
913140639 1:115938111-115938133 CAGCCAAATGCAGCACCTGTGGG + Intergenic
918170254 1:181989542-181989564 CAGCTTTATGGACCTCCTTGAGG - Intergenic
919839650 1:201599515-201599537 CATTCTTCTGTACCACCTGTGGG - Intergenic
920218827 1:204380503-204380525 CAGCCATATGAAACACCTGTAGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
922620852 1:226987239-226987261 CAGGCTTAAGGAGCACTTGTTGG - Exonic
923084241 1:230690320-230690342 CACCCTTGTGGACGGCCTGTGGG + Intronic
1065458042 10:25928135-25928157 CAGCCTGCAGGACCACCTTTGGG - Intergenic
1072654770 10:97322236-97322258 CAGCCTTAAGGCCCACCTTGTGG - Intergenic
1074459559 10:113624915-113624937 CTGCCTTGTAGGCCACCTGTTGG + Exonic
1076945521 10:133646483-133646505 CAGCTCTATGCAGCACCTGTGGG - Intergenic
1076990428 11:270790-270812 CAGCCGTGTGGACCTGCTGTGGG + Intergenic
1081779569 11:45700574-45700596 CAGGCTTATGGAACTCCAGTGGG + Intergenic
1085914795 11:80872829-80872851 CAGTCTTGTGGACTATCTGTGGG + Intergenic
1089768392 11:120785097-120785119 CAGCCTTCTGGACGACTTATGGG - Intronic
1095319306 12:40806539-40806561 CACCCAAATGGACCACCAGTGGG + Intronic
1098047044 12:66410846-66410868 GAACCTTATAGACCACCTGCAGG + Intronic
1099537079 12:83857939-83857961 CATCCATATAGACCACCTGTAGG - Intergenic
1102927397 12:116836563-116836585 CAGCATTCTTGACCCCCTGTGGG + Intronic
1115526576 14:34286088-34286110 TTGCCTTATGGACCAACTATAGG - Intronic
1121493854 14:94378625-94378647 CAGCCTTATGCACGGCCTGGAGG + Exonic
1121526586 14:94623604-94623626 CAGCCTTATGGACCACCTGTGGG - Exonic
1121527669 14:94630628-94630650 CAGCCATAAGCAGCACCTGTGGG - Intergenic
1121952253 14:98181846-98181868 CAGCCTTGTGTACCCCTTGTTGG + Intergenic
1202919543 14_KI270723v1_random:18286-18308 CAGCTCTATGCAGCACCTGTGGG - Intergenic
1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG + Intergenic
1123644375 15:22428405-22428427 CGGCTTTATGGACCACCTGGAGG - Intergenic
1123665694 15:22608307-22608329 CAGCTTTATGGACCACCTGGAGG - Intergenic
1123733932 15:23166959-23166981 CGGCTTTATGGACCACCTGGAGG + Intergenic
1123752066 15:23364345-23364367 CAGCTTTATGGACCACCTGGAGG + Exonic
1123990892 15:25682540-25682562 CAGCCTCCTCGGCCACCTGTGGG - Intronic
1124284437 15:28388270-28388292 CGGCTTTATGGACCACCTGGAGG + Exonic
1124298260 15:28523344-28523366 CGGCTTTATGGACCACCTGGAGG - Exonic
1124319516 15:28702721-28702743 CAGCTTTATGGACCACCTGGAGG - Exonic
1124482996 15:30092710-30092732 CAGCTTTATGGACCACCTGGAGG + Exonic
1124489446 15:30144781-30144803 CAGCTTTATGGACCACCTGAAGG + Exonic
1124520581 15:30404508-30404530 CAGCTTTATGGACCACCTGAAGG - Exonic
1124538075 15:30561711-30561733 CAGCTTTATGGACCACCTGAAGG + Exonic
1124544536 15:30613772-30613794 CAGCTTTATGGACCACCTGGAGG + Exonic
1124564499 15:30801207-30801229 CAGCTTTATGGACCAACTGGAGG + Intergenic
1124754081 15:32393546-32393568 CAGCTTTATGGACCACCTGAAGG - Exonic
1124760576 15:32445874-32445896 CAGCTTTATGGACCACCTGAAGG - Exonic
1124778058 15:32603188-32603210 CAGCTTTATGGACCACCTGAAGG + Exonic
1124959177 15:34382227-34382249 CGGCCTTATGGACCTCCTGGAGG - Exonic
1124975803 15:34528448-34528470 CGGCCTTATGGACCTCCTGGAGG - Exonic
1126996673 15:54452430-54452452 CACCCCTATACACCACCTGTGGG - Intronic
1127058885 15:55161820-55161842 CAGCTTTATGGAGCTGCTGTAGG - Intergenic
1127350513 15:58147370-58147392 CAGCCATTTGAACCATCTGTGGG - Intronic
1129038585 15:72665598-72665620 CAGCTTTATGGACCTCCCGAAGG + Exonic
1129211305 15:74071632-74071654 CAGCTTTATGGACCTCCCGAAGG - Exonic
1129399098 15:75269455-75269477 CAGCTTTATGGACCTCCCGAAGG + Exonic
1129402705 15:75293731-75293753 CAGCTTTATGGACCTCCCGAAGG + Exonic
1132184577 15:99792198-99792220 TGGCCTTATGGACCTCCTGGAGG + Intergenic
1132432402 15:101772458-101772480 TGGCCTTATGGACCTCCTGGAGG - Intergenic
1133046293 16:3090077-3090099 CAGCCTTGTGCAGCACCTGCTGG - Exonic
1134341036 16:13346335-13346357 CAGCTTTATAGAGCACCTGATGG + Intergenic
1137711799 16:50571877-50571899 CAGCCTTATGGACCATGGGAAGG - Intronic
1141695931 16:85619438-85619460 CAGCCTTAAGGGCCACTTCTAGG + Intronic
1147895966 17:43751587-43751609 CAGGCTTATAGACCCCATGTAGG + Intergenic
1152126016 17:78447383-78447405 CGGCCCTCTGGACCTCCTGTGGG + Intronic
1203164818 17_GL000205v2_random:84202-84224 CAGCTCTATGCAGCACCTGTGGG - Intergenic
1157021325 18:43785882-43785904 CAGCCTGATGAACCACATTTAGG - Intergenic
1157724666 18:49954743-49954765 CAGCCTGCAGGACCACCTGAAGG + Intronic
1164436279 19:28232680-28232702 GAGGCTTAGGGACCACATGTTGG - Intergenic
1165059552 19:33198446-33198468 CAGCATTACTGACCACCTGCAGG + Intronic
927496978 2:23557620-23557642 CTGCCTTGGGGACCACCTGCTGG - Intronic
929265986 2:39919999-39920021 CACCTGTATGCACCACCTGTGGG - Intergenic
933791074 2:85884043-85884065 CAGCCTCATTTACCACCTCTAGG + Intronic
936027847 2:109047041-109047063 CAGCCTTATGCACTGCCAGTGGG + Intergenic
938992197 2:136641009-136641031 CAGGCTTCTGAGCCACCTGTGGG - Intergenic
939166094 2:138642849-138642871 CAGCCTGATGGACCAAATCTAGG - Intergenic
942085889 2:172443598-172443620 CAGCCTTATGCCCAAGCTGTTGG + Intronic
946817226 2:223591573-223591595 CAGCATTATGGTCCACTTGAGGG + Intergenic
1169451984 20:5719782-5719804 CAGCCTTATTTACCTCCCGTCGG + Intergenic
1171783509 20:29442577-29442599 CAGCTCTATGCAGCACCTGTAGG - Intergenic
1172271501 20:33657975-33657997 CATCCTCATCGACCACCTGCGGG - Exonic
1176406932 21:6374885-6374907 CAGCTCTATGCAGCACCTGTGGG + Intergenic
1176671348 21:9738025-9738047 CAGCCTTCTGGAGTCCCTGTTGG + Intergenic
1178669978 21:34581790-34581812 CTGCCTTTTGGTCCACATGTAGG - Intronic
1181372442 22:22429071-22429093 CAGCCTCCTGGAGCACCTCTCGG + Intergenic
955854987 3:63263259-63263281 CAGCCACTTGGACCACCAGTTGG + Intronic
956692129 3:71888249-71888271 CAGCTTTAAGTACCATCTGTGGG + Intergenic
957081963 3:75643985-75644007 CAGCTCTATGCAGCACCTGTGGG + Intergenic
969155290 4:5204815-5204837 CTCCCTTATGGACCACTCGTGGG + Intronic
971574820 4:28258955-28258977 CAACCTTATGGAAAAGCTGTAGG + Intergenic
978170535 4:105664924-105664946 CATCATTAAGGAGCACCTGTAGG - Intronic
980192127 4:129538371-129538393 CAGCATTAAGGCCCACCTGGGGG + Intergenic
982382593 4:154765047-154765069 CAGCCTTGAGGAACACCTGGCGG + Intergenic
985403378 4:189613768-189613790 CAGCCTTCTGGAGTCCCTGTTGG - Intergenic
985875006 5:2587621-2587643 CTGCCCTATGGGCCACCTGTAGG + Intergenic
996413224 5:123181634-123181656 CCGCCTTATGTACCTTCTGTAGG + Intronic
1005743731 6:28816606-28816628 CAGTCTTATGGAACATCAGTAGG + Intergenic
1012198823 6:96379481-96379503 CAGGCTAATTGACCTCCTGTTGG - Intergenic
1017093634 6:150784095-150784117 CAACCTTGTGGACCTCCTGAAGG + Intronic
1019045265 6:169140603-169140625 CAGCCGTGGGGACCTCCTGTGGG + Intergenic
1030082166 7:105787420-105787442 CAGGCTTACGGAGCACCTCTGGG - Intronic
1031124369 7:117756619-117756641 CAGCCTTCTTGAGGACCTGTAGG + Exonic
1031374213 7:121004411-121004433 CAGCCTAATGGAACACCTGCCGG - Intronic
1031721559 7:125182133-125182155 CAGCCTTCTGGATCATCTGGAGG + Intergenic
1032528859 7:132603545-132603567 CAGCTTTTTTGACCACCTGCTGG + Intronic
1034191797 7:149218865-149218887 TAGCCTTATGGATCTCCTTTTGG - Intronic
1059629498 9:116105461-116105483 AAGCCTTATAGACAACATGTTGG + Intergenic
1061513040 9:131072490-131072512 CTGCCTTTGGGACTACCTGTTGG + Intronic
1061543078 9:131288780-131288802 CTCCCATCTGGACCACCTGTGGG - Intergenic
1203443528 Un_GL000219v1:33433-33455 CAGCTCTATGCAGCACCTGTGGG - Intergenic
1203514336 Un_KI270741v1:152342-152364 CAGCTCTATGCAGCACCTGTGGG - Intergenic
1188599882 X:31948960-31948982 CAGGCTTATAGATCACCTGTAGG - Intronic
1189147953 X:38674366-38674388 TAGACTTATGGACTGCCTGTAGG + Intronic
1190467556 X:50741132-50741154 CAGACACATGGACCAACTGTAGG - Intronic
1196103641 X:111873370-111873392 TAGGCTGAAGGACCACCTGTTGG + Intronic
1197767751 X:130070023-130070045 CAGCCTGAGAGACCACCTCTAGG + Intronic
1198334109 X:135650616-135650638 CAGCTCTATGCAGCACCTGTGGG + Intergenic
1198339278 X:135698582-135698604 CAGCTCTATGCAGCACCTGTGGG + Intergenic
1200406174 Y:2813666-2813688 CAGCCTAATGGATCATCTTTGGG - Intergenic