ID: 1121529172

View in Genome Browser
Species Human (GRCh38)
Location 14:94640640-94640662
Sequence GCAAGGGTCTGAGCTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121529172_1121529185 30 Left 1121529172 14:94640640-94640662 CCAGGACCAGCTCAGACCCTTGC No data
Right 1121529185 14:94640693-94640715 GCTGAGTCAGACCACTGGAAGGG No data
1121529172_1121529184 29 Left 1121529172 14:94640640-94640662 CCAGGACCAGCTCAGACCCTTGC No data
Right 1121529184 14:94640692-94640714 TGCTGAGTCAGACCACTGGAAGG No data
1121529172_1121529179 4 Left 1121529172 14:94640640-94640662 CCAGGACCAGCTCAGACCCTTGC No data
Right 1121529179 14:94640667-94640689 ATGGATTCCAGACTCCGTGGAGG No data
1121529172_1121529182 25 Left 1121529172 14:94640640-94640662 CCAGGACCAGCTCAGACCCTTGC No data
Right 1121529182 14:94640688-94640710 GGCCTGCTGAGTCAGACCACTGG No data
1121529172_1121529178 1 Left 1121529172 14:94640640-94640662 CCAGGACCAGCTCAGACCCTTGC No data
Right 1121529178 14:94640664-94640686 AAAATGGATTCCAGACTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121529172 Original CRISPR GCAAGGGTCTGAGCTGGTCC TGG (reversed) Intergenic
No off target data available for this crispr