ID: 1121529383

View in Genome Browser
Species Human (GRCh38)
Location 14:94641634-94641656
Sequence CTCCTCAGGCACCACGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121529383_1121529389 -9 Left 1121529383 14:94641634-94641656 CCCTCACCGTGGTGCCTGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1121529389 14:94641648-94641670 CCTGAGGAGGAGATCCAGGAAGG 0: 1
1: 0
2: 1
3: 24
4: 340
1121529383_1121529393 13 Left 1121529383 14:94641634-94641656 CCCTCACCGTGGTGCCTGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1121529393 14:94641670-94641692 GCTTCTGGGATCTGCTGATCAGG 0: 1
1: 0
2: 3
3: 16
4: 150
1121529383_1121529394 21 Left 1121529383 14:94641634-94641656 CCCTCACCGTGGTGCCTGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1121529394 14:94641678-94641700 GATCTGCTGATCAGGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 61
1121529383_1121529395 22 Left 1121529383 14:94641634-94641656 CCCTCACCGTGGTGCCTGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1121529395 14:94641679-94641701 ATCTGCTGATCAGGCTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1121529383_1121529397 27 Left 1121529383 14:94641634-94641656 CCCTCACCGTGGTGCCTGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1121529397 14:94641684-94641706 CTGATCAGGCTCCGTGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 119
1121529383_1121529390 -2 Left 1121529383 14:94641634-94641656 CCCTCACCGTGGTGCCTGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1121529390 14:94641655-94641677 AGGAGATCCAGGAAGGCTTCTGG 0: 1
1: 1
2: 3
3: 36
4: 379
1121529383_1121529396 26 Left 1121529383 14:94641634-94641656 CCCTCACCGTGGTGCCTGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1121529396 14:94641683-94641705 GCTGATCAGGCTCCGTGGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 113
1121529383_1121529391 -1 Left 1121529383 14:94641634-94641656 CCCTCACCGTGGTGCCTGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1121529391 14:94641656-94641678 GGAGATCCAGGAAGGCTTCTGGG 0: 1
1: 2
2: 12
3: 152
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121529383 Original CRISPR CTCCTCAGGCACCACGGTGA GGG (reversed) Intergenic
902833433 1:19032544-19032566 ATCCTAAGGCACCAGGGTGGCGG + Intergenic
903761403 1:25701232-25701254 CTGCTCAGGCACCATGGGAAGGG + Intronic
903961508 1:27060679-27060701 CTCCTCAGACACCGAGTTGAAGG - Intergenic
904641983 1:31938048-31938070 CTCCTCAGTCACCTCGGCGGCGG + Exonic
913138073 1:115911995-115912017 CTCCTCTGGCCCCACCCTGAAGG + Intergenic
913507879 1:119534743-119534765 TTCCCAAGGCACCACAGTGAAGG - Intergenic
917164057 1:172091605-172091627 CTCTTCAGGGAACAAGGTGAAGG + Intronic
918374627 1:183896836-183896858 GTCCTCAGGCACCAGGAGGAAGG + Intronic
920691310 1:208148662-208148684 CCCCTCAGGAAGCCCGGTGATGG + Intronic
1063878351 10:10505358-10505380 CTCCACTGACACCATGGTGAGGG + Intergenic
1069124963 10:64618994-64619016 CTCTACAGACACCACAGTGAGGG - Intergenic
1071709100 10:88031385-88031407 CACCTCAGTAACCAGGGTGAAGG + Intergenic
1074550325 10:114436737-114436759 CTCCCCAGGGACCACGCTGGAGG - Intronic
1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG + Intergenic
1085403108 11:76246271-76246293 GTCCTCAGGGAGCTCGGTGAAGG - Intergenic
1088840742 11:113625477-113625499 CTCCTAAGGCAACAGGGAGATGG - Intergenic
1089304713 11:117519263-117519285 CTCCTGAGGCCCCACGCAGAGGG - Intronic
1091328565 11:134712558-134712580 CTCCACAGACACCTCGGGGAGGG + Intergenic
1097130253 12:56806263-56806285 CTCCTTTGGCACAACCGTGAGGG - Intergenic
1099735124 12:86557502-86557524 GTCCTCAGGCACCATGGTGGTGG - Intronic
1101062205 12:100984028-100984050 CTGCTCAGGCTCCTCAGTGAAGG + Intronic
1105678793 13:22704840-22704862 CTCCTCAGACACAAAAGTGATGG + Intergenic
1106785779 13:33106868-33106890 TTCCTCATGCTCCACGGAGAGGG + Exonic
1107277017 13:38688993-38689015 ATCCACAGGCACTAAGGTGATGG - Exonic
1115805059 14:37041403-37041425 CTCCTCAGGCTCCAGAGTGCTGG - Intronic
1121457374 14:94047022-94047044 GTCCTGAGGCAGCAAGGTGAGGG - Exonic
1121529383 14:94641634-94641656 CTCCTCAGGCACCACGGTGAGGG - Intergenic
1122602008 14:102926220-102926242 CTCCTCAGTCACAATGGTAATGG + Intronic
1124232729 15:27959540-27959562 CTCTAAAGGCATCACGGTGAAGG + Intronic
1124404220 15:29379669-29379691 CTCCTCAGCCACCACCATAAGGG + Intronic
1124971715 15:34495570-34495592 CTCCCCGCGCAACACGGTGATGG - Intergenic
1127546689 15:59999655-59999677 CTCCTGTGGCACCACAGTGCAGG + Intergenic
1127703504 15:61525075-61525097 CTTCTCAGACACCACGGGGTGGG + Intergenic
1127856391 15:62957187-62957209 TTGATCAGGCACCACCGTGAGGG + Intergenic
1128890964 15:71331509-71331531 CTCCACAGGCACCATGGGGCGGG + Intronic
1132045512 15:98559920-98559942 GACCTCAGGCTCCAAGGTGAGGG - Intergenic
1133126418 16:3649698-3649720 CTCCTCCGGCACCACTATCAGGG - Intronic
1133233400 16:4376822-4376844 CTCCCCAGCCCCCAGGGTGAAGG + Intronic
1133239761 16:4407534-4407556 CGCAGCAGGCACCACTGTGAAGG - Exonic
1137352563 16:47726425-47726447 ATCCAGAGGCACCACGGGGAGGG - Intergenic
1138390370 16:56666349-56666371 CTTCTCAAACTCCACGGTGAAGG - Intronic
1138391285 16:56671498-56671520 CTTCTCAAACTCCACGGTGAAGG + Intronic
1139576152 16:67843298-67843320 GTCGTCAGGCACCACGGAGGAGG + Exonic
1139910283 16:70393479-70393501 CTGGTCAGGCACCTCAGTGATGG - Intronic
1141620760 16:85235602-85235624 CTCCTCTGCCACCACGGGGGTGG + Intergenic
1142164292 16:88577471-88577493 CTCCTCAGTCACCAGGGAGCTGG + Exonic
1145276862 17:21436822-21436844 CTCCTCACTCACCACAGTCATGG + Intergenic
1145314696 17:21722715-21722737 CTCCTCACTCACCACAGTCATGG + Intergenic
1145713144 17:26994652-26994674 CTCCTCACTCACCACAGTCATGG + Intergenic
1147428445 17:40357222-40357244 CTCCCCAGCCCCCACTGTGAAGG + Intronic
1147915024 17:43880876-43880898 CTCACCAGGCTGCACGGTGAGGG + Intronic
1151718416 17:75843050-75843072 CTCCTCGGGCTCCACGTGGAAGG + Exonic
1151923502 17:77175540-77175562 CTGCCCGGGCACCACAGTGAAGG - Intronic
1152227087 17:79097553-79097575 CTACTCAGTCAACACGGCGACGG + Intronic
1153900846 18:9615197-9615219 TTCCTCGTGCAGCACGGTGAAGG + Intronic
1160532852 18:79575704-79575726 CATCTCAGGCACCTTGGTGATGG + Intergenic
1162337123 19:10068722-10068744 CTGATCAGGCACCATGCTGAGGG + Intergenic
1163020977 19:14480581-14480603 CTCCCCAGGCACCTTGATGAAGG + Exonic
1163615201 19:18323011-18323033 CCCCGCCGGCACCATGGTGAGGG - Exonic
1165675509 19:37719384-37719406 CTCCTCAGGCCCTAGGGTGCTGG - Exonic
1165996094 19:39845262-39845284 GTGCTCAGGCACCACCGAGAAGG + Intronic
925865633 2:8223768-8223790 CTCCTCAGGCTCCAAGGTGCTGG - Intergenic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
929439345 2:41953116-41953138 TTCCTCAGGCACCTCTGAGAGGG - Exonic
934533083 2:95108175-95108197 CTCCACAGGGACCAGGGTCAGGG + Exonic
948801921 2:240436916-240436938 CTCCTCCGGGACCACAGGGAGGG - Intronic
1171226233 20:23444176-23444198 CTCCTGAGGCACCTGGGTGAAGG + Intronic
1171251591 20:23653158-23653180 CTCCTCCAGCACTATGGTGAGGG + Intergenic
1172442754 20:34977662-34977684 CTACCTCGGCACCACGGTGAGGG - Exonic
1172938654 20:38639369-38639391 CTCACTAGGCACCACGGCGAAGG - Exonic
1175205803 20:57310246-57310268 TTACTCAGTCACCACAGTGAGGG + Intergenic
1175416623 20:58805404-58805426 CTCCTCAGGCACCCTGGGGCTGG + Intergenic
1176069473 20:63218651-63218673 CTCCTCAGGCCTCACTGTGGGGG - Intergenic
1176429608 21:6567713-6567735 CCCCGCAGGCACCAAGCTGACGG + Intergenic
1177003422 21:15640983-15641005 CTCCTCAATCACCACGGAAATGG - Intergenic
1179705002 21:43175175-43175197 CCCCACAGGCACCAAGCTGACGG + Intergenic
1179878633 21:44284326-44284348 CTCCACAGCCACCACTGAGATGG + Intergenic
1181175719 22:21033703-21033725 CTGCTCAGGCAACACAGGGATGG - Intergenic
1181854265 22:25770950-25770972 CTCCTCATCCACCTCAGTGATGG - Exonic
1183979753 22:41532531-41532553 CTTCTCTGACACCACGGGGAAGG + Intronic
1185071211 22:48657660-48657682 CTCCTGCAGCACCACCGTGATGG + Intronic
1185080909 22:48708854-48708876 CTGCTCAGGCAGCAAGGGGAAGG - Intronic
1185389079 22:50549167-50549189 CTCCTCGGGCACCTGGGTCAGGG - Exonic
949982226 3:9508960-9508982 CGCCTCTGGCACCACGGGAATGG - Intronic
951248859 3:20371011-20371033 CTCCTCAGACACCGAGTTGAAGG + Intergenic
951427899 3:22569874-22569896 GTCCTCAGGCAACAGGGTGCTGG + Intergenic
953535327 3:43773040-43773062 GTCCTCAGACACCACTTTGAAGG - Intergenic
954327232 3:49870108-49870130 CTCCTCCGGCCCCAGGCTGAGGG - Exonic
960993545 3:123326689-123326711 CTCCACAGGCACCAGGAAGAGGG - Intronic
961330628 3:126135929-126135951 CCCAGCAGGCACCAAGGTGAGGG - Intronic
963115349 3:141724365-141724387 CCCCTCAGACACCAGGGTGAAGG + Intergenic
963606999 3:147420550-147420572 GTCCTCAGGTTCCACGCTGAAGG - Intronic
968186222 3:196634905-196634927 CTGCTCCGCCACCAAGGTGAAGG + Intergenic
969030015 4:4204310-4204332 CTTCCCAGGCACCTCGGGGAAGG - Intronic
970419479 4:15891946-15891968 CTCCTCTGGCACCTCAGAGAAGG - Intergenic
973236719 4:47914098-47914120 CTCCTCCGGCGCCGCGGAGATGG + Exonic
977705889 4:100069424-100069446 CTCCTGAAGCACCATGTTGATGG + Intergenic
981455441 4:144948044-144948066 ATCCTCTGGCACCACTGTGGTGG + Intergenic
986536356 5:8791976-8791998 CTCCTCAGGCACAAAAGTGAAGG + Intergenic
988610021 5:32714345-32714367 GGCCTCAGCCACCACTGTGAGGG - Intronic
1000320272 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG + Intergenic
1001797306 5:174513289-174513311 TCCCTGAGACACCACGGTGAAGG + Intergenic
1002296071 5:178232148-178232170 CCTCTCAGGCGCCAGGGTGAAGG + Intronic
1003336370 6:5176551-5176573 CTCCTCAGGAACCAATGGGAAGG + Intronic
1003613418 6:7633356-7633378 CTCCTCTGTCACCATGGTAATGG - Intergenic
1007211670 6:40197437-40197459 CTTCTTAGGAACCACTGTGAGGG + Intergenic
1007213372 6:40216400-40216422 TGGCTCAGGCACCATGGTGAAGG + Intergenic
1010068627 6:71715988-71716010 CTCCTCAGCAACCAAGGGGAAGG - Intergenic
1018060007 6:160082829-160082851 CTCCTGAGGCAGCATGGGGAAGG + Intronic
1024122501 7:46259136-46259158 TTCCTCAGACACCACTGTGCAGG + Intergenic
1024715107 7:52070309-52070331 CTCCTCATAAACCACAGTGATGG + Intergenic
1027427076 7:78071937-78071959 TTCCTCAGAGACCACGTTGATGG - Intronic
1032419671 7:131767981-131768003 CTCCTCTGACACCACTGGGATGG + Intergenic
1034967484 7:155400188-155400210 CCCCTCAGTCACCCAGGTGAGGG - Intergenic
1035012112 7:155728368-155728390 CTCCTCAAGCAGCTGGGTGAAGG - Intronic
1035244441 7:157553149-157553171 CTCCTGAGACATCACGTTGAGGG + Intronic
1041464363 8:58144120-58144142 GTCCTCAGGCACAAAGCTGAAGG + Intronic
1045207135 8:100054871-100054893 CTCCTCATGGCCCATGGTGATGG + Intronic
1048049885 8:130806769-130806791 GCCCTCAGGCACCCAGGTGAGGG - Intronic
1049319985 8:141991153-141991175 CTCCTCAGCCTCCACGGTCACGG + Intergenic
1049556196 8:143283453-143283475 CTCCTCAGACACCACCTGGACGG + Intergenic
1049595899 8:143483252-143483274 CTCCCGAGCCAGCACGGTGATGG - Intronic
1050635551 9:7608602-7608624 TTCCTCAGTTACCACTGTGATGG + Intergenic
1051591125 9:18777432-18777454 CTGCTCGGTCACCATGGTGAAGG - Exonic
1058539417 9:105996013-105996035 CATCTCAGGCAGCATGGTGAGGG - Intergenic
1060052635 9:120388122-120388144 CTCCCCAGACACGATGGTGAGGG - Intergenic
1060256041 9:122031842-122031864 CTCCCCAGGCATGACGGAGATGG - Exonic
1061411874 9:130426167-130426189 TTCCCCAGGCCCCAGGGTGAAGG + Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG + Intergenic