ID: 1121529451

View in Genome Browser
Species Human (GRCh38)
Location 14:94641967-94641989
Sequence ATGCTGTGATGGGTGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121529451_1121529458 3 Left 1121529451 14:94641967-94641989 CCTAGCCCCACCCATCACAGCAT No data
Right 1121529458 14:94641993-94642015 GAAAGTGTCCCCTCCTGACTTGG No data
1121529451_1121529463 20 Left 1121529451 14:94641967-94641989 CCTAGCCCCACCCATCACAGCAT No data
Right 1121529463 14:94642010-94642032 ACTTGGATATAGATGACACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121529451 Original CRISPR ATGCTGTGATGGGTGGGGCT AGG (reversed) Intergenic
No off target data available for this crispr