ID: 1121530793

View in Genome Browser
Species Human (GRCh38)
Location 14:94651722-94651744
Sequence CTGGGGGGTGGGGGGGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121530777_1121530793 -6 Left 1121530777 14:94651705-94651727 CCCCCATGGCCCTGTGCCTGGGG No data
Right 1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG No data
1121530774_1121530793 0 Left 1121530774 14:94651699-94651721 CCGTGTCCCCCATGGCCCTGTGC No data
Right 1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG No data
1121530779_1121530793 -7 Left 1121530779 14:94651706-94651728 CCCCATGGCCCTGTGCCTGGGGG No data
Right 1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG No data
1121530781_1121530793 -8 Left 1121530781 14:94651707-94651729 CCCATGGCCCTGTGCCTGGGGGG No data
Right 1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG No data
1121530772_1121530793 13 Left 1121530772 14:94651686-94651708 CCAGGCTTGGCATCCGTGTCCCC No data
Right 1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG No data
1121530783_1121530793 -9 Left 1121530783 14:94651708-94651730 CCATGGCCCTGTGCCTGGGGGGT No data
Right 1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG No data
1121530771_1121530793 18 Left 1121530771 14:94651681-94651703 CCAAACCAGGCTTGGCATCCGTG No data
Right 1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121530793 Original CRISPR CTGGGGGGTGGGGGGGTTGT TGG Intergenic
No off target data available for this crispr