ID: 1121533753

View in Genome Browser
Species Human (GRCh38)
Location 14:94677047-94677069
Sequence TACCTACTCCCTGACCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121533750_1121533753 -3 Left 1121533750 14:94677027-94677049 CCAGATGAGCCTGAACCTCTTAC No data
Right 1121533753 14:94677047-94677069 TACCTACTCCCTGACCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121533753 Original CRISPR TACCTACTCCCTGACCCTTC AGG Intergenic
No off target data available for this crispr