ID: 1121535112

View in Genome Browser
Species Human (GRCh38)
Location 14:94685836-94685858
Sequence ATCCAGCTGGGCCCCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535112_1121535120 3 Left 1121535112 14:94685836-94685858 CCTACAGGGGGGCCCAGCTGGAT No data
Right 1121535120 14:94685862-94685884 CCCACATTCCCAGTGGGCCCAGG No data
1121535112_1121535126 24 Left 1121535112 14:94685836-94685858 CCTACAGGGGGGCCCAGCTGGAT No data
Right 1121535126 14:94685883-94685905 GGCCAGTGTTTCAGAGAGCACGG No data
1121535112_1121535115 -4 Left 1121535112 14:94685836-94685858 CCTACAGGGGGGCCCAGCTGGAT No data
Right 1121535115 14:94685855-94685877 GGATTCCCCCACATTCCCAGTGG No data
1121535112_1121535116 -3 Left 1121535112 14:94685836-94685858 CCTACAGGGGGGCCCAGCTGGAT No data
Right 1121535116 14:94685856-94685878 GATTCCCCCACATTCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535112 Original CRISPR ATCCAGCTGGGCCCCCCTGT AGG (reversed) Intergenic
No off target data available for this crispr