ID: 1121535598

View in Genome Browser
Species Human (GRCh38)
Location 14:94688517-94688539
Sequence CTCTAACCTATGTTGATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535598_1121535599 12 Left 1121535598 14:94688517-94688539 CCATCAATCAACATAGGTTAGAG No data
Right 1121535599 14:94688552-94688574 TAATTTTGTAAAGAAATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535598 Original CRISPR CTCTAACCTATGTTGATTGA TGG (reversed) Intergenic
No off target data available for this crispr