ID: 1121535711

View in Genome Browser
Species Human (GRCh38)
Location 14:94689589-94689611
Sequence CAGGCTGGGTCCACCCCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535711_1121535720 -6 Left 1121535711 14:94689589-94689611 CCACGAGGGGTGGACCCAGCCTG No data
Right 1121535720 14:94689606-94689628 AGCCTGGGCGCGGCTGGCCGGGG No data
1121535711_1121535724 13 Left 1121535711 14:94689589-94689611 CCACGAGGGGTGGACCCAGCCTG No data
Right 1121535724 14:94689625-94689647 GGGGCCTCCGCGCTGGATCCAGG No data
1121535711_1121535722 6 Left 1121535711 14:94689589-94689611 CCACGAGGGGTGGACCCAGCCTG No data
Right 1121535722 14:94689618-94689640 GCTGGCCGGGGCCTCCGCGCTGG No data
1121535711_1121535718 -8 Left 1121535711 14:94689589-94689611 CCACGAGGGGTGGACCCAGCCTG No data
Right 1121535718 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
1121535711_1121535725 14 Left 1121535711 14:94689589-94689611 CCACGAGGGGTGGACCCAGCCTG No data
Right 1121535725 14:94689626-94689648 GGGCCTCCGCGCTGGATCCAGGG No data
1121535711_1121535719 -7 Left 1121535711 14:94689589-94689611 CCACGAGGGGTGGACCCAGCCTG No data
Right 1121535719 14:94689605-94689627 CAGCCTGGGCGCGGCTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535711 Original CRISPR CAGGCTGGGTCCACCCCTCG TGG (reversed) Intergenic