ID: 1121535716

View in Genome Browser
Species Human (GRCh38)
Location 14:94689603-94689625
Sequence CGGCCAGCCGCGCCCAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535716_1121535725 0 Left 1121535716 14:94689603-94689625 CCCAGCCTGGGCGCGGCTGGCCG No data
Right 1121535725 14:94689626-94689648 GGGCCTCCGCGCTGGATCCAGGG No data
1121535716_1121535722 -8 Left 1121535716 14:94689603-94689625 CCCAGCCTGGGCGCGGCTGGCCG No data
Right 1121535722 14:94689618-94689640 GCTGGCCGGGGCCTCCGCGCTGG No data
1121535716_1121535724 -1 Left 1121535716 14:94689603-94689625 CCCAGCCTGGGCGCGGCTGGCCG No data
Right 1121535724 14:94689625-94689647 GGGGCCTCCGCGCTGGATCCAGG No data
1121535716_1121535730 28 Left 1121535716 14:94689603-94689625 CCCAGCCTGGGCGCGGCTGGCCG No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535716 Original CRISPR CGGCCAGCCGCGCCCAGGCT GGG (reversed) Intergenic