ID: 1121535717

View in Genome Browser
Species Human (GRCh38)
Location 14:94689604-94689626
Sequence CCGGCCAGCCGCGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535717_1121535722 -9 Left 1121535717 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
Right 1121535722 14:94689618-94689640 GCTGGCCGGGGCCTCCGCGCTGG No data
1121535717_1121535724 -2 Left 1121535717 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
Right 1121535724 14:94689625-94689647 GGGGCCTCCGCGCTGGATCCAGG No data
1121535717_1121535725 -1 Left 1121535717 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
Right 1121535725 14:94689626-94689648 GGGCCTCCGCGCTGGATCCAGGG No data
1121535717_1121535730 27 Left 1121535717 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data
1121535717_1121535731 30 Left 1121535717 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535717 Original CRISPR CCGGCCAGCCGCGCCCAGGC TGG (reversed) Intergenic