ID: 1121535721

View in Genome Browser
Species Human (GRCh38)
Location 14:94689608-94689630
Sequence GGCCCCGGCCAGCCGCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535721_1121535731 26 Left 1121535721 14:94689608-94689630 CCTGGGCGCGGCTGGCCGGGGCC No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data
1121535721_1121535724 -6 Left 1121535721 14:94689608-94689630 CCTGGGCGCGGCTGGCCGGGGCC No data
Right 1121535724 14:94689625-94689647 GGGGCCTCCGCGCTGGATCCAGG No data
1121535721_1121535730 23 Left 1121535721 14:94689608-94689630 CCTGGGCGCGGCTGGCCGGGGCC No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data
1121535721_1121535725 -5 Left 1121535721 14:94689608-94689630 CCTGGGCGCGGCTGGCCGGGGCC No data
Right 1121535725 14:94689626-94689648 GGGCCTCCGCGCTGGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535721 Original CRISPR GGCCCCGGCCAGCCGCGCCC AGG (reversed) Intergenic
No off target data available for this crispr