ID: 1121535723

View in Genome Browser
Species Human (GRCh38)
Location 14:94689623-94689645
Sequence TGGATCCAGCGCGGAGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535723_1121535730 8 Left 1121535723 14:94689623-94689645 CCGGGGCCTCCGCGCTGGATCCA No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data
1121535723_1121535731 11 Left 1121535723 14:94689623-94689645 CCGGGGCCTCCGCGCTGGATCCA No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535723 Original CRISPR TGGATCCAGCGCGGAGGCCC CGG (reversed) Intergenic