ID: 1121535724

View in Genome Browser
Species Human (GRCh38)
Location 14:94689625-94689647
Sequence GGGGCCTCCGCGCTGGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535721_1121535724 -6 Left 1121535721 14:94689608-94689630 CCTGGGCGCGGCTGGCCGGGGCC No data
Right 1121535724 14:94689625-94689647 GGGGCCTCCGCGCTGGATCCAGG No data
1121535711_1121535724 13 Left 1121535711 14:94689589-94689611 CCACGAGGGGTGGACCCAGCCTG No data
Right 1121535724 14:94689625-94689647 GGGGCCTCCGCGCTGGATCCAGG No data
1121535716_1121535724 -1 Left 1121535716 14:94689603-94689625 CCCAGCCTGGGCGCGGCTGGCCG No data
Right 1121535724 14:94689625-94689647 GGGGCCTCCGCGCTGGATCCAGG No data
1121535717_1121535724 -2 Left 1121535717 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
Right 1121535724 14:94689625-94689647 GGGGCCTCCGCGCTGGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535724 Original CRISPR GGGGCCTCCGCGCTGGATCC AGG Intergenic