ID: 1121535725

View in Genome Browser
Species Human (GRCh38)
Location 14:94689626-94689648
Sequence GGGCCTCCGCGCTGGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535717_1121535725 -1 Left 1121535717 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
Right 1121535725 14:94689626-94689648 GGGCCTCCGCGCTGGATCCAGGG No data
1121535721_1121535725 -5 Left 1121535721 14:94689608-94689630 CCTGGGCGCGGCTGGCCGGGGCC No data
Right 1121535725 14:94689626-94689648 GGGCCTCCGCGCTGGATCCAGGG No data
1121535711_1121535725 14 Left 1121535711 14:94689589-94689611 CCACGAGGGGTGGACCCAGCCTG No data
Right 1121535725 14:94689626-94689648 GGGCCTCCGCGCTGGATCCAGGG No data
1121535716_1121535725 0 Left 1121535716 14:94689603-94689625 CCCAGCCTGGGCGCGGCTGGCCG No data
Right 1121535725 14:94689626-94689648 GGGCCTCCGCGCTGGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535725 Original CRISPR GGGCCTCCGCGCTGGATCCA GGG Intergenic