ID: 1121535727

View in Genome Browser
Species Human (GRCh38)
Location 14:94689632-94689654
Sequence GCGCTTCCCTGGATCCAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535727_1121535740 28 Left 1121535727 14:94689632-94689654 CCGCGCTGGATCCAGGGAAGCGC No data
Right 1121535740 14:94689683-94689705 CAGAGCAGCGTCCACAGCCCGGG No data
1121535727_1121535731 2 Left 1121535727 14:94689632-94689654 CCGCGCTGGATCCAGGGAAGCGC No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data
1121535727_1121535730 -1 Left 1121535727 14:94689632-94689654 CCGCGCTGGATCCAGGGAAGCGC No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data
1121535727_1121535739 27 Left 1121535727 14:94689632-94689654 CCGCGCTGGATCCAGGGAAGCGC No data
Right 1121535739 14:94689682-94689704 CCAGAGCAGCGTCCACAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535727 Original CRISPR GCGCTTCCCTGGATCCAGCG CGG (reversed) Intergenic