ID: 1121535728

View in Genome Browser
Species Human (GRCh38)
Location 14:94689643-94689665
Sequence GTGCGGGGACGGCGCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535728_1121535741 25 Left 1121535728 14:94689643-94689665 CCAGGGAAGCGCCGTCCCCGCAC No data
Right 1121535741 14:94689691-94689713 CGTCCACAGCCCGGGCCTCTCGG No data
1121535728_1121535731 -9 Left 1121535728 14:94689643-94689665 CCAGGGAAGCGCCGTCCCCGCAC No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data
1121535728_1121535740 17 Left 1121535728 14:94689643-94689665 CCAGGGAAGCGCCGTCCCCGCAC No data
Right 1121535740 14:94689683-94689705 CAGAGCAGCGTCCACAGCCCGGG No data
1121535728_1121535739 16 Left 1121535728 14:94689643-94689665 CCAGGGAAGCGCCGTCCCCGCAC No data
Right 1121535739 14:94689682-94689704 CCAGAGCAGCGTCCACAGCCCGG No data
1121535728_1121535743 29 Left 1121535728 14:94689643-94689665 CCAGGGAAGCGCCGTCCCCGCAC No data
Right 1121535743 14:94689695-94689717 CACAGCCCGGGCCTCTCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535728 Original CRISPR GTGCGGGGACGGCGCTTCCC TGG (reversed) Intergenic