ID: 1121535730

View in Genome Browser
Species Human (GRCh38)
Location 14:94689654-94689676
Sequence CCGTCCCCGCACCCGCCACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535717_1121535730 27 Left 1121535717 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data
1121535726_1121535730 2 Left 1121535726 14:94689629-94689651 CCTCCGCGCTGGATCCAGGGAAG No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data
1121535716_1121535730 28 Left 1121535716 14:94689603-94689625 CCCAGCCTGGGCGCGGCTGGCCG No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data
1121535727_1121535730 -1 Left 1121535727 14:94689632-94689654 CCGCGCTGGATCCAGGGAAGCGC No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data
1121535723_1121535730 8 Left 1121535723 14:94689623-94689645 CCGGGGCCTCCGCGCTGGATCCA No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data
1121535721_1121535730 23 Left 1121535721 14:94689608-94689630 CCTGGGCGCGGCTGGCCGGGGCC No data
Right 1121535730 14:94689654-94689676 CCGTCCCCGCACCCGCCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535730 Original CRISPR CCGTCCCCGCACCCGCCACG AGG Intergenic