ID: 1121535731

View in Genome Browser
Species Human (GRCh38)
Location 14:94689657-94689679
Sequence TCCCCGCACCCGCCACGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121535721_1121535731 26 Left 1121535721 14:94689608-94689630 CCTGGGCGCGGCTGGCCGGGGCC No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data
1121535726_1121535731 5 Left 1121535726 14:94689629-94689651 CCTCCGCGCTGGATCCAGGGAAG No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data
1121535728_1121535731 -9 Left 1121535728 14:94689643-94689665 CCAGGGAAGCGCCGTCCCCGCAC No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data
1121535717_1121535731 30 Left 1121535717 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data
1121535727_1121535731 2 Left 1121535727 14:94689632-94689654 CCGCGCTGGATCCAGGGAAGCGC No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data
1121535723_1121535731 11 Left 1121535723 14:94689623-94689645 CCGGGGCCTCCGCGCTGGATCCA No data
Right 1121535731 14:94689657-94689679 TCCCCGCACCCGCCACGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121535731 Original CRISPR TCCCCGCACCCGCCACGAGG CGG Intergenic