ID: 1121537938

View in Genome Browser
Species Human (GRCh38)
Location 14:94704023-94704045
Sequence GACACTCATGCGCTCACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121537929_1121537938 18 Left 1121537929 14:94703982-94704004 CCCAGACTTGACTTGAGACACTG No data
Right 1121537938 14:94704023-94704045 GACACTCATGCGCTCACTGCAGG No data
1121537928_1121537938 24 Left 1121537928 14:94703976-94703998 CCTTCTCCCAGACTTGACTTGAG No data
Right 1121537938 14:94704023-94704045 GACACTCATGCGCTCACTGCAGG No data
1121537931_1121537938 -10 Left 1121537931 14:94704010-94704032 CCCACCCCCACCAGACACTCATG No data
Right 1121537938 14:94704023-94704045 GACACTCATGCGCTCACTGCAGG No data
1121537930_1121537938 17 Left 1121537930 14:94703983-94704005 CCAGACTTGACTTGAGACACTGC No data
Right 1121537938 14:94704023-94704045 GACACTCATGCGCTCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121537938 Original CRISPR GACACTCATGCGCTCACTGC AGG Intergenic
No off target data available for this crispr