ID: 1121539096

View in Genome Browser
Species Human (GRCh38)
Location 14:94711675-94711697
Sequence CCCCCACTCCTTTCGTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121539096_1121539106 30 Left 1121539096 14:94711675-94711697 CCTTTTTACGAAAGGAGTGGGGG No data
Right 1121539106 14:94711728-94711750 TCCAAGGCTGCCTGGGACAGGGG No data
1121539096_1121539100 14 Left 1121539096 14:94711675-94711697 CCTTTTTACGAAAGGAGTGGGGG No data
Right 1121539100 14:94711712-94711734 GAAACTTCCTCTGCTCTCCAAGG No data
1121539096_1121539102 22 Left 1121539096 14:94711675-94711697 CCTTTTTACGAAAGGAGTGGGGG No data
Right 1121539102 14:94711720-94711742 CTCTGCTCTCCAAGGCTGCCTGG No data
1121539096_1121539105 29 Left 1121539096 14:94711675-94711697 CCTTTTTACGAAAGGAGTGGGGG No data
Right 1121539105 14:94711727-94711749 CTCCAAGGCTGCCTGGGACAGGG No data
1121539096_1121539103 23 Left 1121539096 14:94711675-94711697 CCTTTTTACGAAAGGAGTGGGGG No data
Right 1121539103 14:94711721-94711743 TCTGCTCTCCAAGGCTGCCTGGG No data
1121539096_1121539104 28 Left 1121539096 14:94711675-94711697 CCTTTTTACGAAAGGAGTGGGGG No data
Right 1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121539096 Original CRISPR CCCCCACTCCTTTCGTAAAA AGG (reversed) Intergenic
No off target data available for this crispr