ID: 1121539104

View in Genome Browser
Species Human (GRCh38)
Location 14:94711726-94711748
Sequence TCTCCAAGGCTGCCTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121539096_1121539104 28 Left 1121539096 14:94711675-94711697 CCTTTTTACGAAAGGAGTGGGGG No data
Right 1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121539104 Original CRISPR TCTCCAAGGCTGCCTGGGAC AGG Intergenic
No off target data available for this crispr