ID: 1121539560

View in Genome Browser
Species Human (GRCh38)
Location 14:94714870-94714892
Sequence GCCATGTGCTCAGCTCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121539558_1121539560 4 Left 1121539558 14:94714843-94714865 CCCAAAGTGCTAGGGTTACAGGC 0: 248
1: 19236
2: 245831
3: 273908
4: 172646
Right 1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG No data
1121539559_1121539560 3 Left 1121539559 14:94714844-94714866 CCAAAGTGCTAGGGTTACAGGCA 0: 148
1: 9717
2: 112022
3: 244979
4: 241144
Right 1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG No data
1121539551_1121539560 20 Left 1121539551 14:94714827-94714849 CCACCTGCCTTGGCCTCCCAAAG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
Right 1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG No data
1121539553_1121539560 13 Left 1121539553 14:94714834-94714856 CCTTGGCCTCCCAAAGTGCTAGG 0: 6817
1: 95257
2: 215319
3: 232657
4: 146568
Right 1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG No data
1121539556_1121539560 7 Left 1121539556 14:94714840-94714862 CCTCCCAAAGTGCTAGGGTTACA 0: 382
1: 26887
2: 319532
3: 257249
4: 139433
Right 1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG No data
1121539552_1121539560 17 Left 1121539552 14:94714830-94714852 CCTGCCTTGGCCTCCCAAAGTGC 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
Right 1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121539560 Original CRISPR GCCATGTGCTCAGCTCATTT TGG Intergenic
No off target data available for this crispr