ID: 1121541179

View in Genome Browser
Species Human (GRCh38)
Location 14:94727993-94728015
Sequence CCCCCACTGGTCCCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121541174_1121541179 19 Left 1121541174 14:94727951-94727973 CCTTCATTACTGCATGTTTACCT No data
Right 1121541179 14:94727993-94728015 CCCCCACTGGTCCCTGAGGCTGG No data
1121541175_1121541179 -1 Left 1121541175 14:94727971-94727993 CCTGCTGTATAGCAATCTGTCAC No data
Right 1121541179 14:94727993-94728015 CCCCCACTGGTCCCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121541179 Original CRISPR CCCCCACTGGTCCCTGAGGC TGG Intergenic
No off target data available for this crispr