ID: 1121542075

View in Genome Browser
Species Human (GRCh38)
Location 14:94735690-94735712
Sequence CTACCTTGAAGGCGTCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121542072_1121542075 1 Left 1121542072 14:94735666-94735688 CCTGAACTACTGTAAGGACCACA No data
Right 1121542075 14:94735690-94735712 CTACCTTGAAGGCGTCATGCTGG No data
1121542071_1121542075 2 Left 1121542071 14:94735665-94735687 CCCTGAACTACTGTAAGGACCAC No data
Right 1121542075 14:94735690-94735712 CTACCTTGAAGGCGTCATGCTGG No data
1121542069_1121542075 26 Left 1121542069 14:94735641-94735663 CCTTAGGGTCATGTGCTTTGGGA No data
Right 1121542075 14:94735690-94735712 CTACCTTGAAGGCGTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121542075 Original CRISPR CTACCTTGAAGGCGTCATGC TGG Intergenic
No off target data available for this crispr