ID: 1121546568

View in Genome Browser
Species Human (GRCh38)
Location 14:94767832-94767854
Sequence GCTTGGAGCAGTGGGCTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121546559_1121546568 14 Left 1121546559 14:94767795-94767817 CCCGCCGCCTTAGGTTTCTCAGA No data
Right 1121546568 14:94767832-94767854 GCTTGGAGCAGTGGGCTCCGTGG No data
1121546561_1121546568 10 Left 1121546561 14:94767799-94767821 CCGCCTTAGGTTTCTCAGAAGCA No data
Right 1121546568 14:94767832-94767854 GCTTGGAGCAGTGGGCTCCGTGG No data
1121546557_1121546568 22 Left 1121546557 14:94767787-94767809 CCCGTGGACCCGCCGCCTTAGGT No data
Right 1121546568 14:94767832-94767854 GCTTGGAGCAGTGGGCTCCGTGG No data
1121546558_1121546568 21 Left 1121546558 14:94767788-94767810 CCGTGGACCCGCCGCCTTAGGTT No data
Right 1121546568 14:94767832-94767854 GCTTGGAGCAGTGGGCTCCGTGG No data
1121546555_1121546568 23 Left 1121546555 14:94767786-94767808 CCCCGTGGACCCGCCGCCTTAGG No data
Right 1121546568 14:94767832-94767854 GCTTGGAGCAGTGGGCTCCGTGG No data
1121546554_1121546568 24 Left 1121546554 14:94767785-94767807 CCCCCGTGGACCCGCCGCCTTAG No data
Right 1121546568 14:94767832-94767854 GCTTGGAGCAGTGGGCTCCGTGG No data
1121546563_1121546568 7 Left 1121546563 14:94767802-94767824 CCTTAGGTTTCTCAGAAGCAGGG No data
Right 1121546568 14:94767832-94767854 GCTTGGAGCAGTGGGCTCCGTGG No data
1121546560_1121546568 13 Left 1121546560 14:94767796-94767818 CCGCCGCCTTAGGTTTCTCAGAA No data
Right 1121546568 14:94767832-94767854 GCTTGGAGCAGTGGGCTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121546568 Original CRISPR GCTTGGAGCAGTGGGCTCCG TGG Intergenic