ID: 1121549685

View in Genome Browser
Species Human (GRCh38)
Location 14:94789412-94789434
Sequence TGCCATAGTCATGATGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121549685_1121549689 -10 Left 1121549685 14:94789412-94789434 CCTTGCCCATCATGACTATGGCA No data
Right 1121549689 14:94789425-94789447 GACTATGGCATGTGTTACATGGG No data
1121549685_1121549690 -9 Left 1121549685 14:94789412-94789434 CCTTGCCCATCATGACTATGGCA No data
Right 1121549690 14:94789426-94789448 ACTATGGCATGTGTTACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121549685 Original CRISPR TGCCATAGTCATGATGGGCA AGG (reversed) Intergenic
No off target data available for this crispr