ID: 1121553961

View in Genome Browser
Species Human (GRCh38)
Location 14:94822442-94822464
Sequence AATCCTTGGGGAGCCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121553955_1121553961 22 Left 1121553955 14:94822397-94822419 CCATGGCAAAAAGGGCTGGCTGG No data
Right 1121553961 14:94822442-94822464 AATCCTTGGGGAGCCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121553961 Original CRISPR AATCCTTGGGGAGCCTCACA GGG Intergenic
No off target data available for this crispr