ID: 1121554381

View in Genome Browser
Species Human (GRCh38)
Location 14:94825214-94825236
Sequence CTGTGGAAATGGAGTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121554378_1121554381 -7 Left 1121554378 14:94825198-94825220 CCAGTCATCAGGCTGACTGTGGA No data
Right 1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121554381 Original CRISPR CTGTGGAAATGGAGTGCAGT GGG Intergenic
No off target data available for this crispr