ID: 1121556546

View in Genome Browser
Species Human (GRCh38)
Location 14:94842110-94842132
Sequence TAGAACCAATAGGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121556546_1121556550 4 Left 1121556546 14:94842110-94842132 CCATCCACCTCCTATTGGTTCTA No data
Right 1121556550 14:94842137-94842159 TATTTTTTAAACCACTGCTCCGG No data
1121556546_1121556553 24 Left 1121556546 14:94842110-94842132 CCATCCACCTCCTATTGGTTCTA No data
Right 1121556553 14:94842157-94842179 CGGAGCCAGAGCTCTTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121556546 Original CRISPR TAGAACCAATAGGAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr