ID: 1121556546 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:94842110-94842132 |
| Sequence | TAGAACCAATAGGAGGTGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1121556546_1121556550 | 4 | Left | 1121556546 | 14:94842110-94842132 | CCATCCACCTCCTATTGGTTCTA | No data | ||
| Right | 1121556550 | 14:94842137-94842159 | TATTTTTTAAACCACTGCTCCGG | No data | ||||
| 1121556546_1121556553 | 24 | Left | 1121556546 | 14:94842110-94842132 | CCATCCACCTCCTATTGGTTCTA | No data | ||
| Right | 1121556553 | 14:94842157-94842179 | CGGAGCCAGAGCTCTTAATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1121556546 | Original CRISPR | TAGAACCAATAGGAGGTGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||