ID: 1121557372

View in Genome Browser
Species Human (GRCh38)
Location 14:94848644-94848666
Sequence CTTGTCCAAGCCATCCTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121557371_1121557372 -1 Left 1121557371 14:94848622-94848644 CCAAGAAGAATTTTCATGGCATC No data
Right 1121557372 14:94848644-94848666 CTTGTCCAAGCCATCCTATCAGG No data
1121557369_1121557372 17 Left 1121557369 14:94848604-94848626 CCAGGATGTAAAATGAAGCCAAG No data
Right 1121557372 14:94848644-94848666 CTTGTCCAAGCCATCCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121557372 Original CRISPR CTTGTCCAAGCCATCCTATC AGG Intergenic
No off target data available for this crispr