ID: 1121560453

View in Genome Browser
Species Human (GRCh38)
Location 14:94871174-94871196
Sequence GGACACAACATTTCAACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121560453_1121560457 -4 Left 1121560453 14:94871174-94871196 CCTTCCGTTGAAATGTTGTGTCC No data
Right 1121560457 14:94871193-94871215 GTCCTCTTTAGTGGATATGAGGG No data
1121560453_1121560456 -5 Left 1121560453 14:94871174-94871196 CCTTCCGTTGAAATGTTGTGTCC No data
Right 1121560456 14:94871192-94871214 TGTCCTCTTTAGTGGATATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121560453 Original CRISPR GGACACAACATTTCAACGGA AGG (reversed) Intergenic
No off target data available for this crispr