ID: 1121562937

View in Genome Browser
Species Human (GRCh38)
Location 14:94887766-94887788
Sequence CCCCGGGTTGAGCTCTCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121562927_1121562937 1 Left 1121562927 14:94887742-94887764 CCGCCTCGGAAGGACCCCCAGGC No data
Right 1121562937 14:94887766-94887788 CCCCGGGTTGAGCTCTCCGGAGG No data
1121562922_1121562937 17 Left 1121562922 14:94887726-94887748 CCTGGAGGCCTGGTGACCGCCTC No data
Right 1121562937 14:94887766-94887788 CCCCGGGTTGAGCTCTCCGGAGG No data
1121562925_1121562937 9 Left 1121562925 14:94887734-94887756 CCTGGTGACCGCCTCGGAAGGAC No data
Right 1121562937 14:94887766-94887788 CCCCGGGTTGAGCTCTCCGGAGG No data
1121562921_1121562937 26 Left 1121562921 14:94887717-94887739 CCAGTGGGGCCTGGAGGCCTGGT No data
Right 1121562937 14:94887766-94887788 CCCCGGGTTGAGCTCTCCGGAGG No data
1121562928_1121562937 -2 Left 1121562928 14:94887745-94887767 CCTCGGAAGGACCCCCAGGCACC No data
Right 1121562937 14:94887766-94887788 CCCCGGGTTGAGCTCTCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121562937 Original CRISPR CCCCGGGTTGAGCTCTCCGG AGG Intergenic