ID: 1121565944

View in Genome Browser
Species Human (GRCh38)
Location 14:94909021-94909043
Sequence AAGCCTGCTGACTCCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121565938_1121565944 13 Left 1121565938 14:94908985-94909007 CCAAGCTTGCAAGTGACCAAGAA No data
Right 1121565944 14:94909021-94909043 AAGCCTGCTGACTCCAAACATGG No data
1121565937_1121565944 24 Left 1121565937 14:94908974-94908996 CCATCAAGACACCAAGCTTGCAA No data
Right 1121565944 14:94909021-94909043 AAGCCTGCTGACTCCAAACATGG No data
1121565936_1121565944 25 Left 1121565936 14:94908973-94908995 CCCATCAAGACACCAAGCTTGCA No data
Right 1121565944 14:94909021-94909043 AAGCCTGCTGACTCCAAACATGG No data
1121565941_1121565944 -3 Left 1121565941 14:94909001-94909023 CCAAGAAGAGGGTCTCTCCCAAG No data
Right 1121565944 14:94909021-94909043 AAGCCTGCTGACTCCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121565944 Original CRISPR AAGCCTGCTGACTCCAAACA TGG Intergenic
No off target data available for this crispr