ID: 1121566693

View in Genome Browser
Species Human (GRCh38)
Location 14:94915249-94915271
Sequence GTCCTCAGATTCTGGTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121566693_1121566702 19 Left 1121566693 14:94915249-94915271 CCTGAGGACCAGAATCTGAGGAC No data
Right 1121566702 14:94915291-94915313 TGGCAATTTCTTTTAGCTCTCGG No data
1121566693_1121566703 28 Left 1121566693 14:94915249-94915271 CCTGAGGACCAGAATCTGAGGAC No data
Right 1121566703 14:94915300-94915322 CTTTTAGCTCTCGGAGCGTCAGG No data
1121566693_1121566697 -1 Left 1121566693 14:94915249-94915271 CCTGAGGACCAGAATCTGAGGAC No data
Right 1121566697 14:94915271-94915293 CCCGGCTCTCCCTTTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121566693 Original CRISPR GTCCTCAGATTCTGGTCCTC AGG (reversed) Intergenic
No off target data available for this crispr