ID: 1121566697

View in Genome Browser
Species Human (GRCh38)
Location 14:94915271-94915293
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121566695_1121566697 -9 Left 1121566695 14:94915257-94915279 CCAGAATCTGAGGACCCGGCTCT No data
Right 1121566697 14:94915271-94915293 CCCGGCTCTCCCTTTTCCTTTGG No data
1121566693_1121566697 -1 Left 1121566693 14:94915249-94915271 CCTGAGGACCAGAATCTGAGGAC No data
Right 1121566697 14:94915271-94915293 CCCGGCTCTCCCTTTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121566697 Original CRISPR CCCGGCTCTCCCTTTTCCTT TGG Intergenic