ID: 1121566702

View in Genome Browser
Species Human (GRCh38)
Location 14:94915291-94915313
Sequence TGGCAATTTCTTTTAGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121566698_1121566702 -4 Left 1121566698 14:94915272-94915294 CCGGCTCTCCCTTTTCCTTTGGC No data
Right 1121566702 14:94915291-94915313 TGGCAATTTCTTTTAGCTCTCGG No data
1121566695_1121566702 11 Left 1121566695 14:94915257-94915279 CCAGAATCTGAGGACCCGGCTCT No data
Right 1121566702 14:94915291-94915313 TGGCAATTTCTTTTAGCTCTCGG No data
1121566696_1121566702 -3 Left 1121566696 14:94915271-94915293 CCCGGCTCTCCCTTTTCCTTTGG No data
Right 1121566702 14:94915291-94915313 TGGCAATTTCTTTTAGCTCTCGG No data
1121566693_1121566702 19 Left 1121566693 14:94915249-94915271 CCTGAGGACCAGAATCTGAGGAC No data
Right 1121566702 14:94915291-94915313 TGGCAATTTCTTTTAGCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121566702 Original CRISPR TGGCAATTTCTTTTAGCTCT CGG Intergenic
No off target data available for this crispr