ID: 1121566703

View in Genome Browser
Species Human (GRCh38)
Location 14:94915300-94915322
Sequence CTTTTAGCTCTCGGAGCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121566693_1121566703 28 Left 1121566693 14:94915249-94915271 CCTGAGGACCAGAATCTGAGGAC No data
Right 1121566703 14:94915300-94915322 CTTTTAGCTCTCGGAGCGTCAGG No data
1121566701_1121566703 -10 Left 1121566701 14:94915287-94915309 CCTTTGGCAATTTCTTTTAGCTC No data
Right 1121566703 14:94915300-94915322 CTTTTAGCTCTCGGAGCGTCAGG No data
1121566699_1121566703 -3 Left 1121566699 14:94915280-94915302 CCCTTTTCCTTTGGCAATTTCTT No data
Right 1121566703 14:94915300-94915322 CTTTTAGCTCTCGGAGCGTCAGG No data
1121566698_1121566703 5 Left 1121566698 14:94915272-94915294 CCGGCTCTCCCTTTTCCTTTGGC No data
Right 1121566703 14:94915300-94915322 CTTTTAGCTCTCGGAGCGTCAGG No data
1121566696_1121566703 6 Left 1121566696 14:94915271-94915293 CCCGGCTCTCCCTTTTCCTTTGG No data
Right 1121566703 14:94915300-94915322 CTTTTAGCTCTCGGAGCGTCAGG No data
1121566695_1121566703 20 Left 1121566695 14:94915257-94915279 CCAGAATCTGAGGACCCGGCTCT No data
Right 1121566703 14:94915300-94915322 CTTTTAGCTCTCGGAGCGTCAGG No data
1121566700_1121566703 -4 Left 1121566700 14:94915281-94915303 CCTTTTCCTTTGGCAATTTCTTT No data
Right 1121566703 14:94915300-94915322 CTTTTAGCTCTCGGAGCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121566703 Original CRISPR CTTTTAGCTCTCGGAGCGTC AGG Intergenic
No off target data available for this crispr