ID: 1121567335

View in Genome Browser
Species Human (GRCh38)
Location 14:94919984-94920006
Sequence GCTGCCTGCCAGCCACATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121567335_1121567340 20 Left 1121567335 14:94919984-94920006 CCAAGATGTGGCTGGCAGGCAGC No data
Right 1121567340 14:94920027-94920049 ATGTAAAATGCATGGAGGAAGGG No data
1121567335_1121567343 26 Left 1121567335 14:94919984-94920006 CCAAGATGTGGCTGGCAGGCAGC No data
Right 1121567343 14:94920033-94920055 AATGCATGGAGGAAGGGGGTTGG No data
1121567335_1121567342 22 Left 1121567335 14:94919984-94920006 CCAAGATGTGGCTGGCAGGCAGC No data
Right 1121567342 14:94920029-94920051 GTAAAATGCATGGAGGAAGGGGG No data
1121567335_1121567337 12 Left 1121567335 14:94919984-94920006 CCAAGATGTGGCTGGCAGGCAGC No data
Right 1121567337 14:94920019-94920041 AAAAAAAGATGTAAAATGCATGG No data
1121567335_1121567339 19 Left 1121567335 14:94919984-94920006 CCAAGATGTGGCTGGCAGGCAGC No data
Right 1121567339 14:94920026-94920048 GATGTAAAATGCATGGAGGAAGG No data
1121567335_1121567341 21 Left 1121567335 14:94919984-94920006 CCAAGATGTGGCTGGCAGGCAGC No data
Right 1121567341 14:94920028-94920050 TGTAAAATGCATGGAGGAAGGGG No data
1121567335_1121567338 15 Left 1121567335 14:94919984-94920006 CCAAGATGTGGCTGGCAGGCAGC No data
Right 1121567338 14:94920022-94920044 AAAAGATGTAAAATGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121567335 Original CRISPR GCTGCCTGCCAGCCACATCT TGG (reversed) Intergenic
No off target data available for this crispr