ID: 1121571716

View in Genome Browser
Species Human (GRCh38)
Location 14:94951417-94951439
Sequence GTCTGCTTGTGGGGAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121571716_1121571728 9 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571728 14:94951449-94951471 TATTGGAAGGGAGGCAGGCAGGG No data
1121571716_1121571726 4 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571726 14:94951444-94951466 ATGGCTATTGGAAGGGAGGCAGG No data
1121571716_1121571724 -3 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571724 14:94951437-94951459 GACTGCTATGGCTATTGGAAGGG No data
1121571716_1121571729 19 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571729 14:94951459-94951481 GAGGCAGGCAGGGTGTCCAAAGG No data
1121571716_1121571723 -4 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571723 14:94951436-94951458 AGACTGCTATGGCTATTGGAAGG No data
1121571716_1121571725 0 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571725 14:94951440-94951462 TGCTATGGCTATTGGAAGGGAGG No data
1121571716_1121571722 -8 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571722 14:94951432-94951454 AAGCAGACTGCTATGGCTATTGG No data
1121571716_1121571727 8 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571727 14:94951448-94951470 CTATTGGAAGGGAGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121571716 Original CRISPR GTCTGCTTGTGGGGAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr