ID: 1121571721

View in Genome Browser
Species Human (GRCh38)
Location 14:94951428-94951450
Sequence TAGCCATAGCAGTCTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121571721_1121571729 8 Left 1121571721 14:94951428-94951450 CCACAAGCAGACTGCTATGGCTA No data
Right 1121571729 14:94951459-94951481 GAGGCAGGCAGGGTGTCCAAAGG No data
1121571721_1121571726 -7 Left 1121571721 14:94951428-94951450 CCACAAGCAGACTGCTATGGCTA No data
Right 1121571726 14:94951444-94951466 ATGGCTATTGGAAGGGAGGCAGG No data
1121571721_1121571730 21 Left 1121571721 14:94951428-94951450 CCACAAGCAGACTGCTATGGCTA No data
Right 1121571730 14:94951472-94951494 TGTCCAAAGGAATTCAGCTGTGG No data
1121571721_1121571728 -2 Left 1121571721 14:94951428-94951450 CCACAAGCAGACTGCTATGGCTA No data
Right 1121571728 14:94951449-94951471 TATTGGAAGGGAGGCAGGCAGGG No data
1121571721_1121571727 -3 Left 1121571721 14:94951428-94951450 CCACAAGCAGACTGCTATGGCTA No data
Right 1121571727 14:94951448-94951470 CTATTGGAAGGGAGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121571721 Original CRISPR TAGCCATAGCAGTCTGCTTG TGG (reversed) Intergenic
No off target data available for this crispr