ID: 1121571724

View in Genome Browser
Species Human (GRCh38)
Location 14:94951437-94951459
Sequence GACTGCTATGGCTATTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121571717_1121571724 -6 Left 1121571717 14:94951420-94951442 CCTCTTCCCCACAAGCAGACTGC No data
Right 1121571724 14:94951437-94951459 GACTGCTATGGCTATTGGAAGGG No data
1121571716_1121571724 -3 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571724 14:94951437-94951459 GACTGCTATGGCTATTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121571724 Original CRISPR GACTGCTATGGCTATTGGAA GGG Intergenic
No off target data available for this crispr