ID: 1121571726

View in Genome Browser
Species Human (GRCh38)
Location 14:94951444-94951466
Sequence ATGGCTATTGGAAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121571717_1121571726 1 Left 1121571717 14:94951420-94951442 CCTCTTCCCCACAAGCAGACTGC No data
Right 1121571726 14:94951444-94951466 ATGGCTATTGGAAGGGAGGCAGG No data
1121571721_1121571726 -7 Left 1121571721 14:94951428-94951450 CCACAAGCAGACTGCTATGGCTA No data
Right 1121571726 14:94951444-94951466 ATGGCTATTGGAAGGGAGGCAGG No data
1121571720_1121571726 -6 Left 1121571720 14:94951427-94951449 CCCACAAGCAGACTGCTATGGCT No data
Right 1121571726 14:94951444-94951466 ATGGCTATTGGAAGGGAGGCAGG No data
1121571716_1121571726 4 Left 1121571716 14:94951417-94951439 CCACCTCTTCCCCACAAGCAGAC No data
Right 1121571726 14:94951444-94951466 ATGGCTATTGGAAGGGAGGCAGG No data
1121571719_1121571726 -5 Left 1121571719 14:94951426-94951448 CCCCACAAGCAGACTGCTATGGC No data
Right 1121571726 14:94951444-94951466 ATGGCTATTGGAAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121571726 Original CRISPR ATGGCTATTGGAAGGGAGGC AGG Intergenic
No off target data available for this crispr